1. POSTER TEMPLATE BY: www.PosterPresenta tions.com r 2 p 1 Challenging Traditional Approaches to Computation: A Biomolecular Transducer Employing Ternary Language and Rendering a Biological Output Paul Lazarescu and Mark Chaskes Mentor: Tamar Ratner The Schulich Faculty of Chemistry, Technion-Israel Institute of Technology Abstract Molecules Design Discussion Introduction Terms Results Design and Development Conclusions Acknowledgements: We would like to sincerely thank our mentor Tamar Ratner for her dedication, as well as Professor Ehud Keinan for allowing us to use his laboratory. We also would like to thank Mr. Russell N. Stern and the Louis Herman Israel Experience Fund for their generosity and donation. Biomolecular computing is a new field of research, merging several sciences. Previous works were based on finite state automata and have had limited computing capabilities. In this project, a transducer model was used in order to design a biomolecular machine with greater computing potential. In this research, two automata were designed as software for the transducer: one able to divide a ternary input by three and the other by two. By making use of a plasmid this transducer could perform multiple computations consecutively. DNA Based Automaton (Fig. 2): a model that can read DNA symbols and change its state according to the read data. DNA Based Transducer: a more complex version of an automaton, that can both read and print information using double-stranded DNA (dsDNA). Restriction Enzyme Type II (Fig. 2A): cleaves dsDNA at a certain distance from a recognition site. DNA Ligase (Fig. 2A): covalently bonds different fragments of dsDNA to each other. Sticky End (Fig. 2C): unpaired single strand DNA (ssDNA) overhangs. These sequences bond to other DNA sticky ends with complementary base pair sequences. Plasmid: a circular vector found in bacteria, in which a foreign DNA sequence is easily inserted. Two software for a DNA based transducer were created. A variety of molecules were also designed as the components of the transducers. The models and the molecules were simulated and checked using a computer program. The molecules were processed and functioned as expected, and the design worked properly. Creating a biomolecular transducer has not yet been accomplished experimentally. However, this science can have many applications. In the future biomolecular computers will hopefully integrate into biological systems. Because these machines are capable of a biological output, this project is literally cutting-edge science. These devices are unlikely to replace the common computer. Instead, due to their capability for direct interface, the importance of biomolecular computing lies within the integration of biological systems, in fields ranging from medicine to agriculture. Transition Molecules (TM) S 0 to S 0, read 0, print 0 S 0 to S 1, read 1, print 0 S 0 to S 2, read 2, print 0 S 1 to S 0, read 0, print 1 S 1 to S 1, read 1, print 1 S 1 to S 2, read 2, print 1 S 2 to S 0, read 0, print 2 S 2 to S 1, read 1, print 2 S 2 to S 2, read 2, print 2 AGTCTT...8 base...CTCCTCGCAGC...2 base AATCAGAA...pairs...GAGGAGCGTCG...pairs...TCAG 0 BseRI BbvI Figure 5: A. The state of the transducer depends on the way the symbol was cleaved. B. The symbols cleaved in different states leaving unique sticky ends Figure 9: The DM bonds with the cleaved terminator. These molecules instigate a biological function (releasing a drug, giving a bacterial Detection Molecule (DM) TGCTGA...Reporter... AAACGACT....Gene 0....ACGA DNA (Fig. 1): double strand molecule. Made of base pairs: cytosine (C) only bonds to guanine (G), and adenine (A) only bonds to thymine (T). A. B. S0S0 S1S1 r 1 p 0 r 1 p 2 r 2 p 2 r 0 p 1 r 0 p 0 S 0 r0p0 S 0 S 0 r2p1 S 0 S 0 r1p0 S 1 S 1 r1p2 S 0 S 1 r0p1 S 1 S 1 r2p2 S 1 Figure 4: The divide-by-three transducer used in this project. A. A schematic diagram of the transducer. r represents the read symbol and p represents the printed symbol. B. Transition rules of this transducer. Sequences decided upon for each symbol Sticky ends left by sequences cleaved in S 0 Sticky ends left by sequences cleaved in S 1 Sticky ends left by sequences cleaved in S 2 0 1 2 Terminator AGTCTT GGTATT CTCGTT TGCTGA TCAGAA CCATAA GAGCAA ACGACT AGTCTT GGTATT CTCGTT TGCTGA AA AA AA CT GTCTT GTATT TCGTT GCTGA A A A T TCTT TATT CGTT CTGA AGTCTT...8 base...CTCCTCGCAGC...1 base AATCAGAA...pairs...GAGGAGCGTCG...pairs...CCAT AGTCTT...8 base...CTCCTCGCAGC AATCAGAA...pairs...GAGGAGCGTCGGAGC GGTATT...8 base...CTCCTCGCAGC...3 base AACCATAA...pairs...GAGGAGCGTCG...pairs...CAGA GGTATT...8 base...CTCCTCGCAGC...2 base AACCATAA...pairs...GAGGAGCGTCG...pairs...CATA GGTATT...8 base...CTCCTCGCAGC...1 base AACCATAA...pairs...GAGGAGCGTCG...pairs...AGCA Figure 8: The TM for the divide-by-three transducer. For every transition rule of the transducer, one transition molecule had to be designed. Another six transition molecules were created for the divide-by-two transducer. TGCTGA...Reporter... AAACGACT....Gene 1....CGAC TGCTGA...Reporter... AAACGACT....Gene 2....GACT A B C D Figure 1 [1] AATTCGGCCGTT..8 base..CTCCTCGCAGC..8 base..CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAA..pairs..GAGGAGCGTCG..pairs..GAGCAATCAGAATCAGAAACGACTTTAA AATTCGGCCGTTAGTCTT..8 base..CTCCTCGCAGCCTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAA..pairs..GAGGAGCGTCGGAGCAATCAGAATCAGAAACGACTTTAA AATTCGGCCGTT CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGC AATCAGAATCAGAAACGACTTTAA AATTCGGCCGTTAGTCTTCTCGTTAGTCTT TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAG CTTTAA AATTCGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA AATTCGGCCGTTAGTCTT TCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAG TCAGAAACGACTTTAA Input (divide-by-three transducer) First cut by restriction enzymes First Ligation addition of transition molecule S 0 to S 2 ­ (read 2, print 0) Second Cut Repeat cycle of restriction, hybridization, and ligation until the terminator is cleaved Final Cut Final Ligation bonding of detection molecule to sticky ends of terminator BbvI BseRI + (S 0,2) + All TM BbvI BseRI + (S 0,T) + All DM Reporter Gene 0 inserted and can be expressed by bacteria, or, a second computation can occur. BseRI Recognition Site EagI Recognition Site Spacers BbvI Recognition Site 2 0 0 Terminator Plasmid (18 in base ten) 0 2 0 Terminator Terminator Figure 2 [2] Figure 3 Figure 3: The divide-by-two transducer used in this project. The transduer begins in state 0 (S 0 ). A. A schematic diagram of the transducer. 'r' represents the 'read' symbol and 'p' represents the 'printed symbol. B. Transition rules of this transducer. For each transition rule there is a transition molecule. CTCGTT...8 base...CTCCTCGCAGC...4 base AAGAGCAA...pairs...GAGGAGCGTCG...pairs...AGAA CTCGTT...8 base...CTCCTCGCAGC...3 base AAGAGCAA...pairs...GAGGAGCGTCG...pairs...ATAA CTCGTT...8 base...CTCCTCGCAGC...2 base AAGAGCAA...pairs...GAGGAGCGTCG...pairs...GCAA [1] Adapted from the National Human Genome Project [2] M. Soreni, S. Yogev, E. Kossoy, Y. Shoham, E. Keinan, Parallel Biomolecular Computation on Surfaces with Advanced Finite Automata. J. AM. CHEM. SOC. 127, 3935-3943 (2005). S0S0 S1S1 r 1 p 0 r 0 p 1 r 2 p 1 r 1 p 2 r 1 p 1 r 0 p 2 r 2 p 2 r 2 p 0 r 0 p 0 S2S2 S 0 r0p0 S 0 S 0 r1p0 S 1 S 0 r2p0 S 2 S 1 r0p1 S 0 S 1 r1p1 S 1 S 1 r2p1 S 2 S 2 r0p2 S 0 S 2 r1p2 S 1 S 2 r2p2 S 2 B. Figure 4 A. B. Figure 5 Figure 6: An example of a computation process on an input string of 200 (equivalent to 18 10 ), using the DNA based transducer that divides by three. Figure 6 phenotype output, etc.) and print the terminator symbol to continue the computation. Figure 9