1. Lecture 11 Evolution and Development Animal development Phylogenetics: terms and analysis

2. Evolution: explanation for the diversity of life/form. Development: generation of form. Evo Devo is the synthesis of these.

3. General animal life cycle Soma Germ-line fertilization Somatic germ-line division

4. Animal development Sperm Egg Zygote Gametes Development

5. Origins of multicellularity Willmer Invertebrate relationships

6. Implicit phylogenys Primordial ooze worm rat chimp human Primordial ooze humanchimprat worm time

7. Metazoan origins Three techniques used A) examine living organisms B) examine the fossil record C) examine DNA sequence

8. Metazoan origins Considerations when looking at the living A Divergence vs convergence

9. Metazoan origins Considerations when looking at the living A Divergence vs convergence Human and Squid camera eyes

10. Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny

11. Metazoan origins Polyphylogeny vs monophylogeny Polyphylogeny independent evolution of a characteristic Monophylogeny common ancestry

12. Evolution of a chitin exoskeleton Polyphylogeny Monophylogeny Proto-platyhelminthes No exoskeleton Insects Crustacea SpidersInsectsCrustaceaSpiders Common ancestor with an exoskeleton

13. Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time blurs all origins

14. Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time D data set in the present

15. First metazoans Willmer Invertebrate relationships

16. Pseudoceolomates Willmer Invertebrate relationships

17. Worms Willmer Invertebrate relationships

18. Mollusks Willmer Invertebrate relationships

19. Arthropods Willmer Invertebrate relationships

20. Deuterostomes Willmer Invertebrate relationships

21. Organization of the major animal groups Raff The shape of life

22. Organization of the major animal groups Raff The shape of life

23. Organization of the major animal groups Sponge Multicellular Multiple cell types No organized tissues Raff The shape of life

24. Organization of the major animal groups Diploblast Organized tissues Diploblastic ectoderm/endoderm Neuron-no CNS Sensory cells-no PNS Raff The shape of life

25. Organization of the major animal groups Acoelomate Triploblastic: ecto meso endoderms Single gut opening Bilaterally symmetric, A/P axis Organized CNS and PNS No body cavity Raff The shape of life

26. Organization of the major animal groups Pseudocoelomates One side of the body cavity lined with mesoderm Raff The shape of life

27. Organization of the major animal groups Eucoelomates Both sides of the body cavity lined with mesoderm Hydrostatic skeleton Circulatory system Raff The shape of life

28. Proposal for animal phylogeny Willmer Invertebrate relationships

29. Fossils When do we see the first fossil animals?

30. Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found

31. Fossil sponges 640-650 My old

32. Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found

34. Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burrow trace fossils Surface trace fossils

35. Trace and body fossils Carroll et al., From DNA to diversity

36. Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burgess Chengjiang Doushantuo Lantian Avalon

37. Lantian and Avalon Biota

38. Ediacarans: soft body preservation Raff The shape of life

39. Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burgess Chengjiang Doushantuo Lantian Avalon Fossilized embryos Over 550 million years old

40. Doushantuo

41. Bacteria and not embryos?

42. Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burgess Chengjiang Doushantuo Lantian Avalon

43. Chengjiang

44. Burgess shales

45. Soft body preservation Regular preservation

46. Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Porifera Biomarker

47. Biomarkers

49. DNA sequence analysis Organism 1 ATGTCCGTGAGTCGTCGTAGCTGAT Organism 2 ATGTCCGTGAGTCGTCGTAGCTGAT Organism 3 ATGTCAGTGAGACGTCGTAGCTGAT Organism 4 ATGTCAGTGAGTCCTCATAGCTGAT Organism 5 AAGGCCGTGAGACCTCATAGCTGAT

50. rRNA 18S analysis Raff The shape of life

51. Choanoflagellates Cambell Biology

52. Choanoflagellates Cambell Biology GENOME SEQUENCE RECENTLY COMPLETED

53. Traditional phylogeny based on the coelum

54. Simple to complex

55. DNA analysis tells a different story

56. Pseudocoelomy is polyphylogenic Priapulids NematodesRotifers coelomates

57. H Philippe et al. Nature 470, 255-258 (2011) doi:10.1038/nature09676 Animal phylogeny based on mitochondrial proteins reconstructed using the CAT+GTR+ Г model under a Bayesian analysis

58. DNA analysis tells a different story Complex to simple

59. Odontogriphus reburrus: early lophotrochozoan Morris and Caron Science 315, 1255

60. JN Liu et al. Nature 470, 526-530 (2011) doi:10.1038/nature09704 Reconstruction of Diania cactiformis in dorsolateral view. Jointed armored velvet worm Transitional form. 520Mya

61. Base groups Complex to simple

62. Problem with sponges: complex to simple?

63. 0 300 600 900 1200 Protostome/ Deuterostome split Chordata Mullusca Cambrian Vendian Molecular clock analysis

64. 0 300 600 900 1200 ChordataMullusca Cambrian Vendian Molecular clock Biomarker analysis Protostome/ Deuterostome split

65. A complex organism existed at the protostome deuterostome split Carroll et al., From DNA to diversity

66. Is the study of living organisms the study of the radiation of Urbilateria? Carroll et al., From DNA to diversity