Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA Structure & Protein Synthesis. Must Knows Unit 5 – DNA Objectives Describe the location of DNA inside the cell and explain the importance of its.

Similar presentations


Presentation on theme: "DNA Structure & Protein Synthesis. Must Knows Unit 5 – DNA Objectives Describe the location of DNA inside the cell and explain the importance of its."— Presentation transcript:

1 DNA Structure & Protein Synthesis

2

3 Must Knows Unit 5 – DNA Objectives Describe the location of DNA inside the cell and explain the importance of its location. How many chromosomes are found in a human cell and what are the two types. Explain the structure of chromosomes related to chromatids centromeres Double helix Homology (parents) DNA Describe structure and function of the DNA molecule. Backbone Nucleotides Complementary base pairing Summarize the process of DNA replication. How does the structure make it easier for it to undergo self replication? Explain the role of enzymes in the process of replication. Explain how the arrangement of nucleotides in a DNA molecule relates to that arrangement of amino acids in a protein.

4 “the location of DNA inside the cell”

5 “importance of its location” Why does a Eukaryotic Cell store DNA inside the nucleus?

6 “How many chromosomes are found in a human cell…” Humans have 46 Chromosomes. 23 Homologous pairs.

7 “what are the two types?” Sex Chromosomes – Controls the production of proteins that determine whether someone is Male or Female. Autosomal Chromosomes – Controls the production of proteins that control everything else.

8 “structure of chromosomes”

9 Remember: “structure of chromosomes” Terms to Know chromatids centromeres Double helix Homology (parents) DNA

10 “structure of chromosomes…”

11 “structure and function of the DNA molecule”

12 Key Terms – Backbone – Nucleotides – Complementary base pairing

13 “structure and function of the DNA molecule” – What bond holds the nitrogenous bases together? – What chemicals make up a Nucleotides? – What chemicals make up the Backbone? – What are the 4 nitrogenous bases? – How do the nitrogenous bases pair?

14 “structure and function of the DNA molecule”

15 Bell Ringer Draw a strand of DNA and label its parts… Include… – Backbone – Phosphate – Adenine – Guanine – Cytosine – Thymine – Deoxyribose

16

17 DNA Replication Lab Must dos… Follow Lab directions step-by-step Analysis… Must write out questions Answer the questions when directed to do so by the directions Must tape nucleotides after done Conclusion would be in tell-con format (3 paragraphs)

18 “the process of DNA replication” Role of the Helicase and Polymerase Helicase -- Enzyme that unzips the “Double Helix” DNA DNA Polymerase – Enzyme attaches “complementary base pairs” to create two identical DNA Strands

19 “the process of DNA replication” Called the “Replication Fork”

20 “the process of DNA replication” How do the two DNA strands compare? Why does DNA Replication need to occur? What stage of Interphase does DNA Replication occur in?

21 “the process of DNA replication” Occurs in The “S” phase of Interphase

22 PROTEIN SYNTHESIS

23 The Code Create a code using a minimum sequence of numbers from 1-4 (0,5-on cannot be used) that represents each letter in the alphabet. Sequence of numbers cannot repeat? Ex. 1 = A, 2 = B, etc. What was the minimum number you used?

24 Sequence of 1Sequence of 2Sequence of 3 111111A 212112B 313113C 414114D 21121E 22122F 23123G 24124H 31131I 32132J 33133K 34134L 41141M 42142N 43143O 44144P 211Q 212R 213S 214T 221U 222V 223W 224X 231Y 232Z 431Start 432Stop

25 Complete this Code The Secret Code Of Gorbology 222431112131143432142144431131213432143133431111223121213143141121432134 What Message did you get?

26 The Secret Code of DNA

27 22 Essential amino acids Humans can produce 11 of the 22 amino acids. The other 11 must be supplied in the food. Failure to obtain enough of even 1 of the 11 essential amino acids, those that we cannot make, results in degradation of the body's proteins—muscle and so forth—to obtain the one amino acid that is needed the amino acids must be in the food every day. Videos Protein and essential amino acids Essential Amino Acids

28 Question of Thought If there are only 22 amino acids and only 4 nucleotides in DNA, how long is the sequence of nucleotides need to be to code for one amino acid? Answer is 3. It takes 3 nucleotides to code for 1 amino acid, referred to as a “codon”. Proteins are a long chain of amino acids, called a “polypeptide”.

29 Overview of Protein Synthesis Process

30 Step by Step Protein Sythesis

31 Human Genome Project Click Here!

32 Overview of Protein Synthesis DNARNAProtein Transcription Translation Location: - In the Nucleus performed by the RNA Polymerase - In the endoplasmic reticulum performed by the ribosome and the tRNA

33 Definition of Transcribe To make a full written or typewritten copy of The process of Transcription = to make a copy of DNA. This is called RNA. Where: Nucleus Why: So DNA stays protected What would happen if the DNA for making a necessary protein is damaged?

34 Transcription Transcription is the process of creating a complementary RNA copy of a sequence of DNAcomplementaryRNADNA Who: The enzyme RNA Polymerase performs this task, by complementary base pairing. Watch Transcription in Real Time

35 How does transcription work in your world? First you need to know the difference between DNA and RNA DNARNA -Thymine - Sugar in nucleotide is called “Deoxyribose” - DNA molecule is double stranded -Uracil - Sugar in nucleotide is called “Ribose” - RNA molecule is single stranded Venn Diagram

36 RNA v. DNA DNA RNA Stays in Nucleus Thymine Ribose Phosphate Leaves Nucleus Adenine Uracil Double Stranded Cytosine Single Stranded Guanine Made in Nucleus Deoxyribose

37 Transcription RNA Polymerase does the work Attaches Complementary Base pairs (C-G and A-U and T-A and G-C) by using the DNA as a template. The RNA that is created is referred to as mRNA

38 Let’s Practice Transcription If the RNA Polymerase reads the DNA as … ATCGATTTAGCGCCAATT Transcribe the messenger RNA (mRNA) strand above

39 Getting rid of the nonsense Before the mRNA leaves the nucleus it goes through a editing process. Introns are the nonsense that will remain in the nucleus. Exon is the mRNA that will leave the nucleus and travel to the ribosomes.

40 Review of the whole process After the DNA has been transcribed into mRNA by the RNA polymerase and edited leaving the intron behind. The mRNA exits (called the Exons) the nucleus and makes its way to the ribosomes on the Endoplasmic Reticulum.

41 Bellringer Transcribe the following DNA molecule into mRNA ACTGTAGCCCGGTATAAATGA What are the 3 difference between DNA and RNA? 1. 2. 3. What enzyme performs this process? Where does this take place?

42 How do the Ribosomes turn the mRNA into Proteins (translation)? Translation is defined as… expressing of something in different language In Biology Translation is the process where the Ribosome reads the mRNA and turn it into a protein by linking amino acids together.

43 Translation The Ribosome tRNA The Codon The Anti-codon Amino Acids

44 Translation 1.Ribosome reads the mRNA on Codon at a time. 2.For Each Codon, the tRNA matches its complementary base pair (Anti-codon). 3.When a match is created, the amino acids are bonded together and a chain of amino acids are created. Click on picture for animation

45 Translation Table on p 211 Click here for video on how to use the table. Pair up and do the Protein Synthesis Quiz

46 Point Mutations of DNA Mutations of DNA occur to the word that makes sense ATCATTTAGCGCCAATT A point mutation occurs when a single nucleotide is either inserted or deleted What happens to the mRNA when it is created? GA

47 Frameshift Mutations of DNA Mutations of DNA occur to the word that makes sense ATC A frameshift occurs when a single nucleotide is either inserted or deleted forcing the entire sequence to shift over. What happens to the mRNA when it is created? GATTTAGCGCCAATT

48 Griffith’s Experiement Virulent – Microorganism able to cause a disease Vaccine-- Substance made from killed or weakened disease causing agents to increase ones immune system.

49 Human Genome Project Click Here for Video!

50 End of the day assignment Pair up with your tablemate. Go through chapter 9 & 10 and identify all the key terms that we covered. Create 20 note cards to help with your review.


Download ppt "DNA Structure & Protein Synthesis. Must Knows Unit 5 – DNA Objectives Describe the location of DNA inside the cell and explain the importance of its."

Similar presentations


Ads by Google