Download presentation
Presentation is loading. Please wait.
1
Chapter 14. From Gene to Protein Biology 114
2
Metabolism teaches us about genes
Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria) each disease is caused by non-functional enzyme Genes create phenotype A B C D E
4
1 gene – 1 enzyme hypothesis
Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA inactivate a gene wild type grows on “minimal” media sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed to produce a certain amino acid non-functional enzyme = broken gene
5
1941 | 1958 Beadle & Tatum George Beadle Edward Tatum
6
Beadle & Tatum’s Neurospora experiment
7
Where does that leave us?!
So… What is a gene? One gene – one enzyme but not all proteins are enzymes but all proteins are coded by genes One gene – one protein but many proteins are composed of several polypeptides but each polypeptide has its own gene One gene – one polypeptide but many genes only code for RNA One gene – one product but many genes code for more than one product … Where does that leave us?!
8
if you don’t know what a wabbit looks like.
Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene RNA It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. 1990s -- thought humans had 100,000 genes ,000 was considered a good estimate ,000 ,000 is our best estimate polypeptide 1 polypeptide 2 polypeptide 3 gene
9
let’s go back to genes that code for proteins…
The “Central Dogma” How do we move information from DNA to proteins? transcription translation DNA RNA protein For simplicity sake, let’s go back to genes that code for proteins… replication
10
From nucleus to cytoplasm…
Where are the genes? genes are on chromosomes in nucleus Where are proteins synthesized? proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm? messenger RNA nucleus
11
transcription and translation
RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded mRNA, rRNA, tRNA, siRNA…. To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation transcription DNA RNA
12
Transcription Transcribed DNA strand = template strand
untranscribed DNA strand = coding strand Synthesis of complementary RNA strand transcription bubble Enzyme RNA polymerase
13
Transcription in Prokaryotes
Initiation RNA polymerase binds to promoter sequence on DNA Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on DNA = always reads DNA 3'5'
14
Transcription in Prokaryotes
Promoter sequences RNA polymerase molecules bound to bacterial DNA
15
Transcription in Prokaryotes
Elongation RNA polymerase unwinds DNA ~20 base pairs at a time reads DNA 3’5’ builds RNA 5’3’ (the energy governs the synthesis!) No proofreading 1 error/105 bases many copies short life not worth it!
16
Transcription RNA
17
Transcription in Prokaryotes
Termination RNA polymerase stops at termination sequence mRNA leaves nucleus through pores RNA GC hairpin turn
18
Transcription in Eukaryotes
Biology 114
19
Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Exon: Segmnent of DNA that is both transcribed into RNA and translated into protein Intron: Portion of mRNA as transcribed from Eukaryotic DNA that is removed by enzymes before mRNA is translated into proteins intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
20
Transcription in Eukaryotes
3 RNA polymerase enzymes RNA polymerase I only transcribes rRNA genes RNA polymerase I I transcribes genes into mRNA RNA polymerase I I I only transcribes tRNA genes each has a specific promoter sequence it recognizes
21
Transcription in Eukaryotes
Initiation complex transcription factors prokarytoes have 1 the holoenzyme, bind to promoter region upstream of gene proteins which bind to DNA & turn on or off transcription TATA box binding site like a prokaryote, too simple, additional control for time and tissue specific. only then does RNA polymerase bind to DNA
22
Post-transcriptional processing
Primary difference between Pro&Euk Primary transcript eukaryotic mRNA needs work after transcription Protect mRNA from RNase enzymes in cytoplasm add 5' cap add polyA tail Edit out introns A 3' poly-A tail CH3 mRNA 5' 5' cap 3' G P A’s intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript mature mRNA transcript spliced mRNA
23
5’ CAP 3’ Poly Tail “PROTECTION”
Eukaryotes ; The first base in transcript is usually A or G and modified by GTP to the 5’ PO4 group forming a 5’ Cap. The G nucleotide in the cap is joined to the transcript by its 5’ end making the only 5’ to 5’ bond. This protects the mRNA cap from degradation. The Euk transcript is cleaved downstream from (AAUAAA) A series of residues called the 3’ poly a tail are added by poly-A-polymerase. Adds protection.
24
Transcription to translation
Differences between prokaryotes & eukaryotes time & physical separation between processes RNA processing
25
Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing needed
26
DNA mRNA protein From gene to protein transcription translation
aa transcription translation DNA mRNA protein ribosome mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm
27
Removing Introns Intron: Non-coding sequence 24% out of human genome
Exon: expressed 1% encode for proteins Pre-mRNA splicing in the nucleus snRNP cluster to make splicesosome which recognize and cut out introns.
28
How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?
29
Cracking the code 1960 | 1968 Nirenberg & Matthaei
determined 1st codon–amino acid match UUU coded for phenylalanine created artificial poly(U) mRNA added mRNA to test tube of ribosomes, tRNA & amino acids mRNA synthesized single amino acid polypeptide chain phe–phe–phe–phe–phe–phe
30
Heinrich Matthaei Marshall Nirenberg
31
Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids
32
mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein
33
The code For ALL life! Code is redundant Why is this a good thing?
strongest support for a common origin for all life Code is redundant several codons for each amino acid Why is this a good thing? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG
34
How are the codons matched to amino acids?
3' 5' TACGCACATTTACGTACGCGG DNA 5' AUGCGUGUAAAUGCAUGCGCC 3' mRNA codon 3' 5' UAC Met tRNA GCA Arg amino acid CAU Val anti-codon
35
cytoplasm transcription translation protein nucleus
36
tRNA structure “Clover leaf” structure anticodon on “clover leaf” end
amino acid attached on 3' end
37
Loading tRNA Aminoacyl tRNA synthetase
enzyme which bonds amino acid to tRNA endergonic reaction ATP AMP energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome.
38
Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small
39
Ribosomes P site (peptidyl-tRNA site) A site (aminoacyl-tRNA site)
holds tRNA carrying growing polypeptide chain A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain E site (exit site) empty tRNA leaves ribosome from exit site
40
Building a polypeptide
Initiation brings together mRNA, ribosome subunits, proteins & initiator tRNA Elongation Termination
41
Elongation: growing a polypeptide
42
Termination: release polypeptide
Release factor “release protein” bonds to A site bonds water molecule to polypeptide chain Now what happens to the polypeptide?
43
start of a secretory pathway
Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm Protein targeting Signal peptide address label start of a secretory pathway
44
Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA
exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail 3' large subunit polypeptide ribosome 5' tRNA small subunit E P A
45
Put it all together…
46
Any Questions?? Biology 114
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.