1. Making Sense of DNA

2. DNA is a code for making proteins
DNA (Gene) Protein Trait

3. Dilemma DNA Contains sequence for protein
Risky/Dangerous for DNA to leave nucleus
Protein
Made by ribosomes
Ribosomes stuck in cytoplasm

4. Solution– SEND MESSENGER!

5. Step 1- Copy DNA Info on mRNA
DNA creates a message for the ribosome called mRNA.
Messenger RNA (mRNA):
Same structure as DNA (except different type of sugar; ribose instead of deoxyribose)

6. Step 1- Copy DNA Info on mRNA
DNA creates a message for the ribosome called mRNA.
Messenger RNA (mRNA):
Same structure as DNA (except different type of sugar; ribose instead of deoxyribose)
Single stranded

7. Step 1- Copy DNA Info on mRNA
DNA creates a message for the ribosome called mRNA.
Messenger RNA (mRNA):
Same structure as DNA (except different type of sugar; ribose instead of deoxyribose)
Single stranded
Uracil replaces all the thymines.

8. Step 1- Copy DNA Info on mRNA
Write the corresponding RNA strand
TAAGCTACCGAATGGACAACACTTCGACTA
AUUCGAUGGUUACCUGUUGUGAAGCUGA

9. Step 1- Copy DNA Info on mRNA
Transcription video
Start at 20 sec.

10. Step 1- Copy DNA Info on mRNA
Similarities between DNA and RNA: 1. Sugar and phosphate make up the backbone 2. They both have base pairs 3. They both carry the same protein messages

11. Step 2- mRNA leaves nucleus

12. Step 3- mRNA attaches to ribosome at START codon (AUG)
Ribosome finds the START sequence in the mRNA: AUG

13. Remember?
Ribosome- ___________________

14. Remember?
Ribosome- makes protein

15. Step 4- tRNA brings the correct amino acid

16. Step 4- tRNA brings the correct amino acid
Each sequence of 3 bases corresponds to 1 amino acid
Codon- sequence of 3 bases that codes for an amino acid

17. Step 4- tRNA brings the correct amino acid
Transfer RNA (tRNA)- brings amino acids to the ribosome.

18. (Why sequence of 3?) There are 20 common amino acids.
Could you make 20 different combinations with 2 bases?
How many different combinations can you make with 3 bases?

19. Step 5- Amino Acids link to form Protein

20. Step 5- Amino Acids link to form Protein
tRNA brings the next amino acid.
Peptide bonds- connect amino acids together to form a protein
Protein- chain of amino acids that fold into a specific shape.

21. Step 6- tRNA reaches STOP codon
The process continues until the STOP codon: UAG, UAA, UGA
Then the protein is complete.

22. Putting it all together
Video 1
Video 2

23. Ticket How does the DNA code get to the ribosome?
Which amino acid would match the mRNA code: CCA?

25. Short cut

26. Practice
DNA code: TACGTTCGAATT mRNA code: Amino acid code:

27. Project-Based Assessment #3
Project choices: Cancer (any genes)

28. MS. HERMAN FARTED !!!!!!