1. 2007 – 2009 publications Macrocyclic lactone resistance: 1. Understanding resistance mechanisms to different MLs 2. Progress with possible markers for ML resistances Roger Prichard Institute of Parasitology McGill University, Montreal, Canada

2. Ligand-gated ion channels

3. Fig. 4. Dose-response curves for L-glutamate at mutant H. contortus GluClα3B channels., wild-type; ✖, V235A;, E114G;, L256F. McCaverna et al. Mol. Pharmacol. 2009 H. contortus GluClα3B expressed in Xenopus oocytes The effects of ivermectin resistance-associated mutations on the ability of glutamate to activate H. contortus GluCl3B channels (mean SEM) Mutation EC50 for L-Glutamate Hill Number Wild type 27.6 ±2.7 1.89 ± 0.35 E114G 31.5 ± 3.2 1.48 ± 0.31 V235A 26.2 ± 2.5 1.97 ± 0.35 L256F 92.2 ± 3.5*** 1.09 ± 0.16** T300S No channels ** p 0.01, *** p 0.001

4. Radioligand binding assays using [3H]ivermectin and membrane preparations from COS-7 cells transfected with wild-type and mutant H. contortus GluClα3B. The insets show the Scatchard plots for each mutant. McCaverna et al. Mol. Pharmacol. 2009 The effects of mutations in H. contortus GluClα3B on binding of 3 [H]ivermectin to membrane preps from transfected COS-7 cells. Mean± SEM Mutation Kd 3 [H]Ivermectin Binding, nM Wild type 0.35 ± 0.1 E114G 0.39 ± 0.07 V235A 0.32 ± 0.09 L256F 2.26 ± 0.78*** L256W 2.51 ± 0.7*** L256Y 1.84 ± 0.49*** L256V 0.79 ± 0.24* T300S 0.76 ± 0.25 * p< 0.05; *** p< 0.001

5. Annelies Van Zeveren in her Ph.D. studies looked for the L256F SNP, in GluClα3 homolog, in an ivermectin resistant strain of Ostertagia ostertagi that she and her colleagues had experimentally selected, but did not find the L256F mutation. L256F, in GluClα3, may be quite rare in different nematode isolates. However, if it does occur it does seem to produce an ‘IVM-resistance phenotype’

6. A dopamine-gated ion channel (HcGGR3*) from Haemonchus contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance Rao VT, Siddiqui SZ, Prichard RK, Forrester SG. Mol Biochem Parasitol. 2009 Jul;166(1):54-61. Epub 2009 Mar 4.

7. Electrophysiology of HcGGR3 in Xenopus laevis oocytes Response to dopamine Response to other amines HcGGR3 forms a homomeric channel and is primarily gated by dopamine Rao et al. Mol. Biochem. Parasitol. 2009

8. Expression of HcGGR3 in lab macrocyclic lactone (ML)-selected strains of Haemonchus contortus ( ♀ ) qPCR: Standard curve relative quantification method Fold change as compared to expression in PF23 strain (normalized with 18srRNA) anova: P<0.0001 HcGGR3 is down regulated in lab strains of ML- selected worms Level of expression in PF23 strain PF23: ML sensitive strain IVF23 & MOF23: Lab selected strains Rao et al. Mol. Biochem. Parasitol. 2009

9. Genotyping of Hcggr3 for the region encoding 3’ UTR (single ♂ s) N = 30 Selection of HcGGR3 allele in Macrocyclic lactone resistance GGTGGGTAAACGATAGATCAACTATATCGCACATAAAAAATACAATGCAAACACATATTTTGTAAA CGTTAATTCCACCGTAGCCAATTAACCGTATAAATATGCAATTCAACCTAATTGAGTTGCATTATCA CATTCGTTGATTTCTCTAAATGTAGAGAGTTGAGGAG PF23: ML sensitive strain IVF23 & MOF23: Lab selected strains Heterozygous: T/C Homozygous: T/T Rao et al. Mol. Biochem. Parasitol. 2009

10. Pharyngeal pump rates of wild-type C. elegans after 2.5 h exposure to 2-fold serial dilutions of IVM and MOX (mean ± SD). A circle ( ) represents pumping rate in non-treated worms, a triangle ( ) indicates pumping rate in IVM exposed worms and a square ( ) indicates pumping rate in MOX exposed worms. Ardelli et al. 2009 Vet Parasitol

11. Motility phenotype of wild-type C. elegans after exposure to 2.5 nM of drug (mean ± SD). A circle ( ) represents velocity in non-treated worms, a triangle ( ) indicates velocity in IVM exposed worms and a square ( ) indicates velocity in MOX exposed worms Ardelli et al. 2009 Vet Parasitol

12. Transcriptional profiles of GluCl genes in wild-type C. elegans after exposure to 2.5 nM of IVM or MOX for 2h (mean ± SD). The black bars represent gene transcription after exposure to IVM and the grey bars represent gene transcription after exposure to MOX. The y-axis represents the fold change in transcription relative to non-treated controls and listed along the x-axis is the C. elegans gene. Changes that are statistically different between the drug treatments (p < 0.05) following IVM or MOX exposure are indicated with. Ardelli et al. 2009 Vet Parasitol

13. ABC transporters

14. Effect of the ivermectin (IVE) and selamectin (SEL)] on mitoxantrone (MXR) accumulation mediated by human ABCG2 and murine Abcg2. Transduced MDCKII cells were preincubated with or without Ko143 (1 µM) or the other tested compounds (50 µM). Mean MXR fluorescence is shown in terms of relative arbitrary units. The bars indicate the means ± S.D. ** p< 0.01, comparing the difference between human ABCG2- and murine Abcg2- transduced MDCKII cells. §§, p< 0.01, comparing the difference between IVE and SEL in murine Abcg2-transduced cells. §§§, p< 0.001, comparing the difference between IVE and SEL in human ABCG2-transduced cells. Merino et al. Drug Met. Disp. 2009 Natural Allelic Variants of Bovine ATP- Binding Cassette Transporter ABCG2: Increased Activity of the Ser581 Variant and Development of Tools for the Discovery of New ABCG2 Inhibitors Selamectin was a significantly more potent inhibitor of the Tyr581 variant compared with the wild-type Ser581 Half-transporters

15. Cross-resistance to anthelmintics. C. elegans L1s in M9 buffer were incubated in serial dilutions of moxidectin (MOX), levamisole (LEV), albendazole (ALB) or pyrantel (PYR), and their fold-resistance determined in IVR6 (solid) and IVR10 (hatched) relative to Bristol N2 strain (1; dotted line). James & Davey, Int. J. Parasitol. 2008 IVM selection on C. elegans

16. ABC transporter gene expression in ivermectin-resistant Caenorhabditis elegans. pgp-1, pgp-2, mrp-1, mrp-2, mrp-5 and mrp-6 were amplified from cDNA using gene-specific primers in IVR6 (solid) and IVR10 (hatched) strains cultured with ivermectin. James & Davey, Int. J. Parasitol. 2008. ‘Natural’ IVM resistance in C. elegans results in overexpression of a number of ABC transporter genes ( Pgps & mrps )

17. The expression of gcs-1 and gstp-1 (B) was examined in IVR6 (solid) and IVR10 (hatched) strains cultured on ivermectin. Bars show means ± SD of the fold change in gene expression relative to the Bristol N2 strain from 2 independent experiments. * indicates P≤0.05; ** indicates P≤0.01. James & Davey, Int. J. Parasitol. 2008. c-glutamylcysteine synthetase (gcs-1), the rate-limiting enzyme for glutathione synthesis was overexpressed in IVR10, while a glutathione transferase π (gstp-1) was overexpressed in IVR6

18. Allelic variation in an Onchocerca volvulus ABC transporter was reduced in IVM-treated human populations in Ghana in 1999 Ardelli & Prichard, Trans R Soc Trop Med Hyg. 2007, 101:1223

19. 0 5 10 15 20 25 30 35 40 45 50 AA CC AA AA CG AA AA GG TT AG CC AA AG CG AA AG CG AT AG CG TT AG GG AA AG GG AT AG GG TT GG CG TT GG GG AT GG GG TT Frequency P=0.0077 P=0.048 P=0.029 P=0.054 BEFORE IVM AFTER IVM 13x PLP (half-transporter) Genotype before IVM and after 13X IVM: Onchocerca volvulus Fisher’s exact test Pre IVM= 66 Post IVM=35 Female worms Allelic selection after 13 three-monthly doses of IVM in female worms Loss of polymorphism. Bourguinat et al. 2008 Mol Biochem Parasitol Position 1 =AA/AG/GG Position 2 =CC/CG/GG Position 4 =AA/AT/TT

20. Mrp expression in C. elegans following exposure to 2.5 nM IVM, compared with wild-type worms not exposed to drug Mrp expression in C. elegans following expsure to 2.5 nM MOX, compared with wild-type worms not exposed to drug B Ardelli & Prichard J. Helminthol. in press

21. Analysis of H. contortus showed that expression of both thioredoxin 12-kDa (HcTrx1) and the 16-kDa (HcTrx3) genes were increased in an IVM-resistant strain relative to a sensitive strain. Sotirchos, Hudson, Ellis & Davey. Free Radic Biol Med. 2008 Thioredoxins and IVM resistance

22. β-tubulin and ML resistance

23. H. contortus: Comparison of the frequency of 200TTC-phenylalanine, 200TTC/TAC-phenylalanine/tyrosine and 200TAC-tyrosine in unselected (PF), IVM selected (IVF) and MOX selected (MOF) strains Tyr at amino acid 167 or 200: PF = 11.1%; IVF = 48.1%; MOF = 51.9% Mottier & Prichard 2008 Pharmacogenetics & Genomics β-tubulin

24. BEFORE TX AFTER TX Onchocerca volvulus: β- tubulin Female worms after 13 x IVM N before=183 N after 4 doses=59 N after 13 doses=39 IVM selection caused a significant change in β-tubulin genotype Bourguinat et al. 2007 PLoS NTD Before and after 13 three-monthly doses 0 20 40 60 80 aaabbb Genotype Frequency Fisher’s exact test P=1e-6 P=1e-8

25. TAC/TTC in H. contortus β-tubulin in Swedish flocks which had been under BZ or ML treatment “An allele frequency of ≥65% was detected in one of the two flocks in 13 (29%) of the 45 farms examined. On many farms (24, 25, 33, 36, 37, 39, 42, 43 and 44) the allele frequency was similar in both the BZ and ML treated flocks” Höglund et al. Vet Parasitol, 2009

26. Conclusions ML resistances appear to be multigenic Phenotypic effects of IVM & MOX markedly different Differences in genes implicated in IVM & MOX resistances Possibly GluCls involved in ML resistances, but data not conclusive ABC transporters induced & overexpressed in ML resistances, but not same between IVM & MOX MLs select on β-tubulin Thioredoxins may also be overexpressed in ML resistances