1. Biol 3300 Objectives for Genomics Students will be able to describe map-based and whole genome sequencing approaches explain how genetic and physical chromosome maps are prepared access and use genetic information from public databases, given a particular problem in biotechnology, medicine, or biology

2. Lecture Outline I.Three types of maps associated with the genome A.Cytogenetic mapping 1)Banding pattern 2)In situ hybridization—FISH and chromosome painting B.Linkage mapping (create a genetic map) C.Physical mapping II.Types of molecular markers A.RFLP B.AFLP C.Minisatellites and microsatellites D.SNPs E.STS III.Molecular markers can be mapped A.Linkage mapping B.LOD mapping in human genetics IV.Methods of Physical mapping I.Creating a contig II.Examples of vectors that can take large chromosomal DNA fragments III.Early sequencing strategies IV.An example of 2 nd generation sequencing--

4. Genomics--the study of the entire genome (not just one gene at a time)

5. (a) Chromosome 5(b) A child with cri-du-chat syndrome Deleted region © Biophoto Assocates/Science Source/Photo Researchers © Jeff Noneley G-banding and deletions used to map some genes/phenotypes

6. A 1 Cytogenetic map: Linkage map: Physical map: sc (1A8)w (3B6) w s c 1.5 mu w sc ~ 2.4 x 10 6 bp 122334 BCDEFAAABBB CCC DDEEFF Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Brooker, Figure 21.1 Results from each type of mapping technique may be slightly different Three types of maps associated with the Genome

7. For cytogenetic mapping: fluorescence in situ hybridization (FISH)

8. Brooker, Figure 21.2 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Sister chromatids Treat cells with agents that make them swell and fixes them onto slide. Denatured DNA (not in a double- helix form) Denature chromosomal DNA. Hybridized probe View with a fluorescence microscope. Fluorescent molecule bound to probe Add fluorescently labeled avidin, which binds to biotin. For cytogenetic mapping: fluorescence in situ hybridization (FISH) Add single-stranded DNA probes that have biotin incorporated into them.

9. Brooker Fig 21.4 Homozygous for polymorphic EcoR1 site Homozygous for loss of EcoR1 site Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Individual 1 EcoRI Individual 2 EcoRI 2000 bp5000 bp1500 bp 3000 bp 2500 bp 2000 bp5000 bp1500 bp3000 bp2500 bp 2000 bp5000 bp4500 bp2500 bp 2000 bp5000 bp4500 bp2500 bp RFLP Analysis of different individuals (molecular marker for genetic and physical mapping)

10. (Most restriction sites are shared in the population  if restriction segments are found in 99% of individuals then it is considered monomorphic.) Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Brooker, Fig 21.4 123 5000 bp 4500 bp 3000 bp 2000 bp 2500 bp 1500 bp Polymorphic bands indicated at arrows. Separate the DNA fragments by gel electrophoresis. Cut the DNA from all 3 individuals with EcoRI. EcoRI 2000 bp 5000 bp1500 bp 3000 bp 2500 bp EcoRI 2000 bp 5000 bp4500 bp2500 bp Individual 3 Heterozygous for polymorphic EcoR1 site RFLP Analysis, cont. (molecular marker for genetic and physical mapping)

11. Southern Blot only shows the polymorphic band Figure not in Brooker Probe must bind to a polymorphic site (molecular marker for genetic and physical mapping)

12. SNP variation—Single Nucleotide Polymorphisms www.hapmap.org (molecular marker for genetic and physical mapping)

13. Microsatellites (or Short Tandem Repeats--STR) CA = (CA) 1 CACACACACA = (CA) 5 CACACACACACACACACACACACACACA = (CA) 14 2 bp repeat TTTTC = (TTTTC) 1 TTTTCTTTTCTTTTC = (TTTTC) 3 TTTTCTTTTCTTTTCTTTTCTTTTCTTTTC = (TTTTC) 5 5 bp repeat (molecular marker for genetic and physical mapping)

14. The same forward and reverse primers PCR- amplify different allele lengths for a microsatellite (CA) 1 allele 5’-…gggaaacctgCAtcgtgccagctg…-3’ (CA) 5 allele 5’-…gggaaacctgCACACACACAtcgtgccagctg…-3” (CA) 8 allele 5’-…cgggaaacctgCACACACACACACACAtcgtgccagctg…-3’ 5’GGGAAA3’ 3’GTCGAC5’ 5’GGGAAA3’ 3’GTCGAC5’ 5’GGGAAA3’ 3’GTCGAC5’

15. Gel electrophoresis Many cycles of PCR produce a large amount of DNA fragment between the 2 primers. Add PCR primers specific to polymorphic chromosome 2 STR Set of chromosomes 2 2 Brooker, Fig 21.5 PCR of microsatellites (CA) 10 allele (CA) 5 allele (molecular marker for genetic and physical mapping)

16. Brooker, Fig 20.12 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 154 150 146 140 Fragment length (bp) Parents Offspring Sue Mary Henry JoelleHank MaryJoelleHankSueHenry Electrophoretic gel of polymorphic microsatellite found in family (PCR amplified)

17. RFLPs (and other markers) can be mapped Figure not in Brooker 16 recombinants/100 total offspring  16 mu

18. Using markers to map BRCA2 gene in humans Fig from Wooster et al., 1995

19. The likelihood of linkage between two markers is determined by the lod (logarithm of the odds) score method – Computer programs analyze pooled data from a large number of pedigrees or crosses involving many markers – They determine probabilities that are used to calculate the lod score lod score = log 10 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Probability of a certain degree of linkage Probability of independent assortment In human genetics, computer algorithms are used to determine linkage

20. Booker, fig 21.7 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Numbers denote chromosome order of clones AB AB F F GH CD C BC D D E EF I I I J J K K K L LM M NO P P P Q R QR Vector Clone individual chromosome pieces into vectors 135 8642 79 10 Collection of ordered, overlapping clones (contig) M Physical Mapping

21. Examples of different types of vectors and host organisms Genome of Interest Host Organism VectorSize of Insert Human genome YeastYAC (Yeast Artificial Chromosome) 100 - 2000 kb Worm (nematode) genome BacteriaCosmid< 45 kb Firefly genome Virus phage < 20 kb Drosophila genome BacteriaPlasmid< 15 kb

22. Selectable Marker gene TEL ORI (E.coli origin of replication) ORI CEN (yeast centromere) CEN Selectable marker gene Selectable marker gene Selectable marker gene TEL (yeast telomere) TEL Yeast artificial chromosome (YAC) Cut with EcoRI and BamHI. Left arm Mix and add DNA ligase. Note: not drawn to scale. Chromosomal DNA is much larger than the YAC vector. Chromosomal DNA Right arm Fragment not needed in yeast Cut (occasionally) with low concentration of EcoRI to yield very large fragments. EcoRI site ARS (yeast origin of replication) ARSLarge piece of chromosomal DNA BamHI site BamHI site + + Brooker, Fig 21.9 Each arm has a different selectable marker. Therefore, it is possible to select for yeast cells with YACs that have both arms Yeast Artificial Chromosomes

23. lacZ HindIII BamHI SphI parC parB parA oriS repE cm R Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Bacterial Artificial Chromosome

24. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display AB F F GH CD C BC D D E E I I J K K K L LM M NO P P Q R Vector 135 8642 79 10 M Which clones will the green probe detect? The red probe?

25. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display AB F F GH CD C BC D D E E I I J K K K L LM M NO P P Q R Vector 135 8642 79 10 M Which clones will the green probe detect? The red probe?

26. Figure 21.8 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Genes A and B mapped previously to specific regions of chromosome 11 – Gene A was found in the insert of clone #2 – Gene B was found in the insert of clone #7 So Genes A and B can be used as reference points to align the members of the contig 1.5 mu Gene A Region of chromosome 11 Gene AGene B 1 2 3 456 7 Linking the genetic map to physical map

27. 12345 Numbers indicate regions that are subcloned. (Starting clone) Subclone*. (with radiolabeled nucleotides) Cosmid vector Subclone*. Screen a library. (Third clone) Repeat subcloning and screening until gene A is reached. (Second clone)....n Gene B Gene A Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 2 2 23 n Figure 20.18 The number of steps required to reach the gene of interest depends on the distance between the start and end points

28. Brooker, Fig 21.14 Chromosomal DNA Chromosomal DNA BAC vector BAC contig Clones from one BAC insert: Vector Clone large chromosomal DNA fragments into BACs and create a contig for each chromosome. Shear DNA into small and large pieces. Clone chromosomal DNA pieces into vectors. For each BAC, shear into smaller pieces and clone DNA pieces into vectors. From the clones of each BAC, determine the chromosomal DNA sequence, usually at one end, by shotgun sequencing. The results below show the sequences from three chromosomal DNA clones. Based on overlapping regions, create one contiguous sequence. Chromosomal DNA (a) Hierarchical genome shotgun sequencing(b) Whole-genome shotgun sequencing CCGACCTTACCGACCA CTTACCCGACCGACCACCCGATTAATCGCGAATTG GACCACCCGATTAAT TTAATCGCGAATTG Determine the chromosomal DNA sequence, usually at both ends, by shotgun sequencing. The results below show sequences of three chromosomal DNA clones. Based on overlapping regions, create one contiguous sequence. TTACCGGTAGGCACCT GGTAGTTACCGCACCTGTTACGGGTCAAACCTAGG CACCTGTTACGGGTC GGGTCAAACCTAGG Isolate chromosomal DNA Isolate chromosomal DNA

30. Emulsify the beads so there is only one bead per droplet. The droplets also contain PCR reagents that amplify the DNA. Deposit the beads into a picotiter plate. Only one bead can fit into each well. Add sequencing reagents: DNA polymerase, primers, ATP sulfurylase, luciferase, apyrase, adenosine 5′ phosphosulfate, and luciferin. Sequentially flow solutions containing A, T, G, or C into the wells. In the example below, T has been added to the wells. PPi (pyrophosphate) is released when T is incorporated into the growing strand. Isolate genomic DNA and break into fragments. Covalently attach oligonucleotide adaptors to the 5′ and 3′ ends of the DNA. Denature the DNA into single strands and attach to beads via the adaptors. Note: Only one DNA strand is attached to a bead. Fragment of genomic DNA Adaptors PPi+ Adenosine 5′ phosphosulfate ATP + luciferin ATP sulfurylase Light Light is detected by a camera in the sequencing machine. Luciferase Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. C A T G C A T T Primer Brooker, Fig 21.15

31. Brooker, Fig 21.11 Chromosome 16 95 million bp Low resolution (3–5 million bp) High resolution (1–100,000 bp) pq 13.2 13.13 13.12 13.11 12.312.2 12.1 11.2 11.113.021.022.122.222.323.123.223.324.124.224.3 D16S85D16S60 D16S159 D16S48 D16S150D16S149 D16S160D16S40D16S144 500 times expansion 219 bp Cytogenetic map (resolution of in situ hybridization 3–5 megabases) Physical map of overlapping cosmid clones (resolution 5–10 kilobases) Sequence-tagged site (resolution 1 base) YAC N16Y1 150,000 bp STS N16Y1-10 Primer 3′ 5′ * * GATCAAGGCGTTACATGA 5′—GATCAAGGCGTTACATGA—3′ CTAGTTCCGCAATGTACT Cosmid contig 211 310C4 N16Y1-29 N16Y1-18 N16Y1-10 N16Y1-19 309G11 312F1 5F3 N16Y1-30 N16Y1-16 N16Y1-12 N16Y1-14 N16Y1-13 = (GT) n Linkage map (resolution 3–5 cM; not all linkage markers are shown) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. D16AC6.5 3′ 5′ AGTCAAACGTTTCCGGCCTA 3′ TCAGTTTGCAAAGGCCGGAT AGTCAAACGTTTCCGGCCTA * * Linking all the maps