Presentation is loading. Please wait.

Presentation is loading. Please wait.

Deoxyribonucleic Acid ( DNA ) The heredity molecule controlling the activities on the cell. The DNA Line-up.

Similar presentations


Presentation on theme: "Deoxyribonucleic Acid ( DNA ) The heredity molecule controlling the activities on the cell. The DNA Line-up."— Presentation transcript:

1 Deoxyribonucleic Acid ( DNA ) The heredity molecule controlling the activities on the cell. The DNA Line-up

2 What’s So Special About DNA? DNA is one of the most boring macromolecules imaginable - its made of only four building blocks and has a perfectly monotonous structure. Worse yet, DNA just sits there - it doesn’t catalyze reactions or build the cell or organism. So, what’s so good about DNA? The answer lies in DNA’s ability to store and copy information.

3 Structure The double helix structure of DNA was first described in 1953 by James Watson & Francis Crick. This was marked one of the most significant discovers of the twentieth century.

4 Winners of the Race to Learn DNA’s Structure – Watson and Crick 50 Years Ago

5 Nucliotide The building block of the DNA ladder Composed of: Phosphate Deoxyribose sugar Nitrogen base

6 Building DNA Building Blocks

7 There are Four kinds of Nitrogen Bases Purines Pyrimidines Adenine-----------------Thymine Guanine-----------------Cytosine (Hydrogen bonds) A always pairs with T G always pairs with C Made of Two RingsMade of One Ring

8 Matching DNA Nitrogen Bases G

9 AACTTCGA A TCCCCC G GGGTTA

10 AACTTCGA A AATTTT TCCCCC GG G GGGG GGGTT CCCAAA A GCT

11 Key words of DNA shape Double stranded ladder shape sides of sugar and phosphate rings of bases coil into (double helix)

12 Replication Making an exact copy of a DNA molecule (self doubling)

13 DNA Replication DNA perfectly illustrates the relationship between structure and function.

14 Simple As It Is in Principle, DNA Replication Requires Many Enzymes That Work Coordinately First and foremost are the DNA polymerases

15 Protein Synthesis The Process of making proteins Transcription – The process of copying the DNA pattern into messenger RNA Messenger RNA – Brings coded information from DNA to the ribosomes Ribosomes – The protein factories in the cell

16 Protein Synthesis Translation – The process of changing the information of messenger RNA into proteins Transfer RNA – The TNA that carries the amino acids to the ribosomes and pairs them with mRNA Codon – Combination of 3 bases on mRNA that determines the order of amino acids

17 RNA Differences Ribose sugar Uricil instead of Thymine Single stranded helix mRNA, tRNA, rRNA Found in nucleus and in the cytoplasm Smaller in size

18 ACGTGTGAGTCGTAGCTGGTA and label the codon with its appropriate Amino Acid. Transcribe the following strand of DNA to a strand of mRNA:

19 How Do Genes Work? The answer is the purview of molecular genetics.


Download ppt "Deoxyribonucleic Acid ( DNA ) The heredity molecule controlling the activities on the cell. The DNA Line-up."

Similar presentations


Ads by Google