Download presentation
Presentation is loading. Please wait.
1
Controlling Gene Expression
Timothy G. Standish, Ph. D.
2
All Genes Can’t be Expressed At The Same Time
Some genes are needed for the function of all cells all the time. These genes are called constitutive genes and are expressed by all cells. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled in most cells. For example, beta cells in the pancreas make the protein insulin by expressing the insulin gene. If neurons expressed insulin, problems would result.
3
Operons Are Groups Of Genes Expressed By Prokaryotes
The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together
4
The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose Lactose is a sugar that E. coli is unlikely to encounter, so it would be wasteful to produce the proteins needed to metabolize it unless necessary Metabolizing lactose for energy only makes sense when two criteria are met: Other more readily metabolized sugar (glucose) is unavailable Lactose is available
5
The Lac Operon - Parts The lac operon is made up of a control region and four genes The four genes are: LacZ - b-galactosidase - An enzyme that hydrolizes the bond between galactose and glucose LacY - Codes for a permease that lets lactose across the cell membrane LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain Repressor - A protien that works with the control region to control expression of the operon
6
The Lac Operon - Control
The control region is made up of two parts: Promoter These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur The lac operon promoter also has a binding site for another protein called CAP Operator The binding site of the repressor protein The operator is located down stream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe
7
The Lac Operon: When Glucose Is Present But Not Lactose
Come on, let me through Repressor mRNA Hey man, I’m constitutive RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding Repressor No way Jose! Repressor CAP
8
The Lac Operon: When Glucose And Lactose Are Present
Great, I can transcribe! Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding X Repressor Repressor Lac This lactose has bent me out of shape Repressor CAP Some transcription occurs, but at a slow rate
9
The Lac Operon: When Lactose Is Present But Not Glucose
Bind to me Polymerase Yipee…! Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding CAP cAMP X Repressor Repressor CAP cAMP Lac Repressor This lactose has bent me out of shape CAP cAMP
10
The Lac Operon: When Neither Lactose Nor Glucose Is Present
Alright, I’m off to the races . . . Bind to me Polymerase Repressor mRNA Hey man, I’m constitutive Come on, let me through! RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding CAP cAMP STOP Right there Polymerase CAP cAMP CAP cAMP
11
The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: Using a repressor that works in exactly the opposite way from the lac operon repressor Using a special attenuator sequence
12
The Tryptophan Biochemical Pathway
COO- H CH2 C HO O Chorismate O -OOC OH HN H -2O3P CH2 5-Phosphoribosyl- a-Pyrophosphate PPi N-(5’- Phosphoribosyl) -anthranilate Antrhanilate COO- NH2 Glutamate + Pyruvate Glutamine Anthranilate synthetase (trpE and D) N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) Tryptophan synthetase (trpB and A) N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase -OOC OH -2O3PO CH2 N H C Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate CO2+H2O -2O3PO CH2 C H OH N Indole-3-glycerol phosphate Glyceraldehyde- 3-phosphate N H Indole N H -OOC CH2 NH3+ C Tryptophan H2O Serine
13
The Trp Operon: When Tryptophan Is Present
Repressor mRNA Hey man, I’m constitutive Foiled Again! RNA Pol. Repressor Promo. trpD trpB Lead. Operator trpA trpC trpE Aten. Trp Repressor STOP Right there Polymerase Repressor Trp
14
Attenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes
15
Transcription And Translation In Prokaryotes
3’ 5’ 5’ mRNA RNA Pol. Ribosome Ribosome
16
The Trp Leader and Attenuator
Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator 4 1 2 3
17
The mRNA Sequence Can Fold In Two Ways
4 1 2 3 4 1 2 3 Terminator haripin
18
The Attenuator When Starved For Tryptophan
3’ 5’ Ribosome RNA Pol. Help, I need Tryptophan 4 1 2 3
19
The Attenuator When Tryptophan Is Present
3’ 5’ 4 1 2 3 Ribosome RNA Pol. RNA Pol.
20
Control Of Expression In Eukaryotes
Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site In addition to controling transcription, there are additional ways in which expression can be controlled in eukaryotes
21
Eukaryotes Have Large Complex Geneomes
The human genome is about 3 x 109 base pairs or ≈ 1 m of DNA Because humans are diploid, each nucleus contains 6 3 x 109 base pairs or ≈ 2 m of DNA That is a lot to pack into a little nucleus!
22
Eukaryotic DNA Must be Packaged
Eukaryotic DNA exhibits many levels of packaging The fundamental unit is the nucleosome, DNA wound around histone proteins Nucleosomes arrange themselves together to form higher and higher levels of packaging.
23
Highly Packaged DNA Cannot be Expressed
The most highly packaged form of DNA is “heterochromatin” Heterochromatin cannot be transcribed, therefore expression of genes is prevented Chromosome puffs on some insect chomosomes illustrate where active gene expression is going on
24
Only a Subset of Genes is Expressed at any Given Time
It takes lots of energy to express genes Thus it would be wasteful to express all genes all the time By differential expression of genes, cells can respond to changes in the environment Differential expression, allows cells to specialize in multicelled organisms. Differential expression also allows organisms to develop over time.
25
Control of Gene Expression
DNA Cytoplasm Nucleus Nuclear pores Packaging Degradation RNA Transcription Modification Ribosome Translation Transportation G AAAAAA RNA Processing mRNA Degradation etc. G AAAAAA G AAAAAA Export
26
Logical Expression Control Points
DNA packaging Transcription RNA processing mRNA Export mRNA masking/unmasking and/or modification mRNA degradation Translation Protein modification Protein transport Protein degradation Increasing cost The logical place to control expression is before the gene is transcribed
27
A “Simple” Eukaryotic Gene
Transcription Start Site 3’ Untranslated Region 5’ Untranslated Region Introns 5’ 3’ Exon 1 Int. 1 Exon 2 Int. 2 Exon 3 Promoter/ Control Region Terminator Sequence Exons RNA Transcript
28
Enhancers 5’ 3’ 3’ 5’ TF TF 3’ 5’ TF DNA Many bases Enhancer Promoter
Transcribed Region TF 3’ 5’ TF TF 3’ 5’ TF RNA Pol. 5’ RNA Pol.
29
Eukaryotic mRNA RNA processing achieves three things:
5’ Untranslated Region 3’ Untranslated Region 5’ G 3’ Exon 1 Exon 2 Exon 3 AAAAA Protein Coding Region 5’ Cap 3’ Poly A Tail RNA processing achieves three things: Removal of introns Addition of a 5’ cap Addition of a 3’ tail This signals the mRNA is ready to move out of the nucleus and may control its life span in the cytoplasm
30
The End
Similar presentations
