Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genomics and Inheritance. What is DNA? What is DNA Day?

Similar presentations


Presentation on theme: "Genomics and Inheritance. What is DNA? What is DNA Day?"— Presentation transcript:

1 Genomics and Inheritance

2 What is DNA?

3 What is DNA Day?

4 April 1953 Drs. James Watson and Francis Crick determined the structure of DNA (double helix)

5 April 2003 Human Genome Project determined the entire DNA sequence of a human (3 billion letters) What is DNA Day? April 1953 Drs. James Watson and Francis Crick determined the structure of DNA (double helix)

6 A Genome is an entire set of an organism’s DNA J Craig Venter Institute The Human Genome 23 pairs of chromosomes

7 A Genome is an entire set of an organism’s DNA J Craig Venter Institute The Human Genome Mother (Maternal) Father (Paternal) 23 pairs of chromosomes One from your mother, one from your father

8 A Genome is an entire set of an organism’s DNA J Craig Venter Institute The Human Genome Cell

9 DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides

10 DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides A Adenine

11 DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides A T Adenine Thymine

12 DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides A T C Adenine Thymine Cytosine

13 DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides A T C G Adenine Thymine CytosineGuanine

14 DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism Two DNA molecules

15 DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism A pairs with T C pairs with G Which is how DNA forms a double helix. Adenine Thymine Cytosine Guanine Base Pair Two DNA molecules

16 “DNA sequence” is the order of nucleotides on a DNA molecule DNA double helix

17 “DNA sequence” is the order of nucleotides on a DNA molecule DNA double helix If we unwind it and look at one strand…

18 “DNA sequence” is the order of nucleotides on a DNA molecule ACCATCGTGCATGTCTC DNA double helix If we unwind it and look at one strand… we can see its sequence

19 The beginning sequence of chr1. The whole human genome take 6.3 million of these slides. CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGT GTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTG GAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATCTT CTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGAT TGGAGGAAAGATGAGTGAGAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTA GTGCTTGTGCTCATCTCCTTGGCTGTGATACGTGGCCGGCCCTCGCTCCAGCAGCTG GACCCCTACCTGCCGTCTGCTGCCATCGGAGCCCAAAGCCGGGCTGTGACTGCTCA AGCCAGCCGGCTGGAGGGAGGGGCTCAGCAGGTCTGGCTTTGGCCCTGGGAGAG CAGGTGGAAGATCAGGCAGGCCATCGCTGCCACAGAACCCAGTGGATTGGCCTAG GTGGGATCTCTGAGCTCAACAAGCCCTCTCTGGGTGGTAGGTGCAGAGACGGGAG GGGCAGAGCCGCAGGCACAGCCAAGAGGGCTGAAGAAATGGTAGAACGGAGCAG CTGGTGATGTGTGGGCCCACCGGCCCCAGGCTCCTGTCTCCCCCCAGGTGTGTGGT GGCTCTGGATGCCAGGCATGCCCTTCCCCAGCATCAGGTCTCCAGAGCTGCAGAAG ACGACGGCCGACTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAGGTGAG A

20 Some sections of the genome are genes Gene – DNA instructions to make a protein Protein – a large molecule that does work for the cell rcsb.org

21 A T C G NucleotidesLetters The genome is like a cookbook for the cell

22 A T C G NucleotidesLetters A sequence of nucleotides composes a gene. GeneRecipe The genome is like a cookbook for the cell

23 A T C G NucleotidesLetters A sequence of nucleotides composes a gene. GeneRecipe Billions of nucleotides are packaged into chromosomes. GenomeCookbook The genome is like a cookbook for the cell Cell Gene Wikimedia commons

24 Refresher: What are each of these? nia.nih.gov

25 Refresher: What are each of these? Cell Nucleotides Genes Chromosome Genome DNA nia.nih.gov

26 No two genomes are the same Individuals differ at about.1% of their nucleotides. Variant - A position in the genome where individuals have different nucleotides Broad Institute Variant

27 No two genomes are the same Individuals differ at about.1% of their nucleotides. Variant - A position in the genome where individuals have different nucleotides 3 billion nucleotides 3 million variants.1%

28 No two genomes are the same Individuals differ at about.1% of their nucleotides. Variant - A position in the genome where individuals have different nucleotides 3 billion nucleotides 3 million variants.1% …………………………….. 123 million AGCTAGCT AGCTAGCT AGCTAGCT 4 choices at 3 million places  4 3million unique genomes

29 ll Please PAUSE to complete the activity

30 Actually, some genomes are the same Identical twins have the same genome. Martin Schoeller for National Geographic

31 Actually, some genomes are the same A single individual is produced. A zygote multiplies and develops. Normal Zygote: A fertilized egg develops into one individual. http://www.mun.ca/biology/desmid/brian/BIOL3530/

32 Actually, some genomes are the same The zygotes develop into individuals with identical genomes. A multiplying zygote splits into two independent zygotes. Identical Twins: A fertilized egg splits into two identical zygotes early on. http://www.mun.ca/biology/desmid/brian/BIOL3530/

33 Actually, some genomes are the same Clones have the same genome.

34 Actually, some genomes are the same To clone an animal you need a body cell and an egg cell. Body cell Egg cell bbc.co.uk

35 Actually, some genomes are the same Replace the genome of the egg cell with that of the cell to be cloned. Body cell Egg cell Extract genome Remove genome Replace egg cell’s genome bbc.co.uk

36 Actually, some genomes are the same Place the dividing egg cell into the uterus of a foster mother. Body cell Egg cell Extract genome Remove genome Replace egg cell’s genome Place egg into foster mother Clone of sheep A bbc.co.uk

37 Your list of variants is your genotype Variants Example chromosome Maternal T A G T C A.….. ….

38 Your list of variants is your genotype Variants Example chromosome Maternal T A G T C A.….. …. G T T T C A C A A G Genotype M

39 Your list of variants is your genotype Variants Example chromosome MaternalPaternal T A G T C A.….. …. C A T T A G …. Genotype G T T T C A C A A G MP

40 Your list of variants is your genotype Variants Example chromosome MaternalPaternal T A G T C A.….. …. C A T T A G …. Genotype G T T T C A C A A G Genotype – The variant nucleotides on both maternal and paternal chromosomes. Your genotype is unique. MP

41 Genomic variants result in unique individuals

42 Big genomic variations allow for many different forms of life

43 Variations in the DNA of different individuals can cause changes in physical appearance or can even cause disease.

44 Variants can result in big changes The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. Sickle-shaped diseased red blood cell Normal red blood cell University of Michigan

45 Variants can result in big changes …CTC……CTC… The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. Sickle-shaped diseased red blood cell Normal red blood cell University of Michigan

46 Variants can result in big changes …CAC……CAC……CTC……CTC… The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. Sickle-shaped diseased red blood cell Normal red blood cell Variant Normal Disease University of Michigan

47 TATTAA Genotypes observed Different genotypes have different outcomes

48 TATTAA Genotypes observed Normal Mostly NormalSickle Cell Anemia microscopyu.com http://legacy.owensboro.kctcs.edu/ micro-scopic.tumblr.com

49 microscopyu.com http://legacy.owensboro.kctcs.edu/ micro-scopic.tumblr.com TATTAA Genotype Sickle Cell count The variant is correlated to the disease

50 Genotype AAATTT Sickle Cell count

51 The variant is correlated to the disease TATTAA Genotype Sickle Cell count steep slope = correlation

52 Other variants show no disease correlation The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: Chr11:119,553,795 C/A variant

53 Other variants show no disease correlation The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: Chr11:119,553,795 C/A variant Genotype Sickle Cell count CCCAAA

54 Other variants show no disease correlation The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: Chr11:119,553,795 C/A variant CCCAAA Genotype Sickle Cell count no slope = no correlation

55 Plot genotype vs. disease state to find how correlated a variant is to the disease TATTAA Genotype Disease Correlated Not Correlated CCCAAA Genotype Disease

56 Genome Wide Association Studies find variants correlated to a disease or trait 1. Pick a disease or trait to test 2. Find individuals with and without the disease/trait DiseaseNo Disease

57 Genome Wide Association Studies find variants correlated to a disease or trait 3. Get genotypes of the individuals 4. Test variants for their correlation to disease/trait AAATTT Genotype Disease or CCCAAA Genotype Disease T C A A T C A T C A A

58 Most traits are controlled by more than one variant Skin color is determined by 12 different variants. 531,441 different combinations of these variants! Sturm, R.A. Hum Mol Gen

59 ll Please PAUSE to complete the activity

60 Every cell in your body has the same genome, except… If you are a mosaic or a chimera, some cells in your body carry a different genome. Nature Review Genetics

61 Every cell in your body has the same genome, except… © Garland Science One zygote Mutation Fusion or exchange of cells Mosaic Chimera Two zygotes If you are a mosaic or a chimera, some cells in your body carry a different genome.

62 Every cell in your body has the same genome, except… © Garland Science One zygote Mutation Fusion or exchange of cells Mosaic Chimera Two zygotes If you are a mosaic or a chimera, some cells in your body carry a different genome.

63 The 1000 Genomes Project medschool.wustl.edu

64 Genomics tells us about ancestry

65 Klyosov and Rozhanskii, 2012

66 Genomics is creating the field of “personalized medicine” Treatments may one day be customized to your genome.

67 What do I study? Why do I love science? Questions? About the Scientist:


Download ppt "Genomics and Inheritance. What is DNA? What is DNA Day?"

Similar presentations


Ads by Google