1. 9/17/2015fatchiyah, JB-UB Gene Regulatory ByFatchiyah(fatchiya@ub.c.id) Dept. of Biology, Brawijaya University

2. 9/17/2015fatchiyah, JB-UB Regulation of Genes What turns genes on (producing a protein) and off? What turns genes on (producing a protein) and off? Where (in which cells) is a gene turned on? Where (in which cells) is a gene turned on? When is a gene turned on or off? When is a gene turned on or off? How many copies of the gene product are produced? How many copies of the gene product are produced?

3. 9/17/2015fatchiyah, JB-UB Overview of Gene Control The mechanisms that control the expression of genes operate at many levels. The mechanisms that control the expression of genes operate at many levels. source: Molecular Biology of the Cell (4 th ed.), A. Johnson, et al.

4. 9/17/2015fatchiyah, JB-UB Multi-scale Model Problem Organizational Structure in Biology Organizational Structure in Biology –Single Cells (Building blocks) –Tissues (organization of multiple cells) –Organism Fundamental Cellular Processes Fundamental Cellular Processes –Inputs (Signal Transduction) –Transcription –Translation –Outputs – adaptive processes

5. 9/17/2015fatchiyah, JB-UB DNA to chromosome M ovie: DNA to ChromosomeThe structure of DNA dictates the way it encodes genetic information. A strand of DNA consists of three types of fundamental chemical units, repeated many times.

6. 9/17/2015fatchiyah, JB-UB Prokaryote regulation Lac operon Lac operonoperon

7. 9/17/2015fatchiyah, JB-UB Transcriptional Regulation The transcription of each gene is controlled by a regulatory region of DNA relatively near the transcription start site (TSS). The transcription of each gene is controlled by a regulatory region of DNA relatively near the transcription start site (TSS). two types of fundamental components two types of fundamental components –short DNA regulatory elements –gene regulatory proteins that recognize and bind to them.

8. 9/17/2015fatchiyah, JB-UB Gene Signals in DNA CpG islands; methylation patterns; promotors Polymerase binding site; cofactors binding sites; enhancer; silencer transcription start sites; introns Donors; acceptors; branch point Termination signals

9. 9/17/2015fatchiyah, JB-UB Regulation of Genes (1) RNA polymerase (Protein) Transcription Factor (Protein) source: M. Tompa, U. of Washington Regulatory Element DNA ATG Start site Gene Termination site

10. 9/17/2015fatchiyah, JB-UB Regulation of Genes (2) GeneRegulatory Element DNA source: M. Tompa, U. of Washington Transcription ATG

11. 9/17/2015fatchiyah, JB-UB Regulation of Genes (3) DNA source: M. Tompa, U. of Washington ATG mRNA Protein ATG

12. 9/17/2015fatchiyah, JB-UB Animation Transcription regulatory Transcription regulatory Transcription regulatory Transcription regulatory Post-Transcription regulation Post-Transcription regulation Post-Transcription regulation Post-Transcription regulation

13. 9/17/2015fatchiyah, JB-UB Post translation Post translation

14. 9/17/2015fatchiyah, JB-UB Cellular Processes

15. 9/17/2015fatchiyah, JB-UB Alignment of CpG island Transcription start (homology-based assignment) TATA-box CpG island mRNA

16. 9/17/2015fatchiyah, JB-UB Gene Regulatory Motif A subsequence (substring) that occurs in multiple sequences with a biological importance. A subsequence (substring) that occurs in multiple sequences with a biological importance. Motifs can be totally constant or have variable elements. Motifs can be totally constant or have variable elements. Protein Motifs often result from structural features. Protein Motifs often result from structural features. DNA Motifs (regulatory elements) DNA Motifs (regulatory elements) –Binding sites for proteins –Short sequences (5-25) –Up to 1000 bp (or farther) from gene –Inexactly repeating patterns What is a motif?

17. 9/17/2015fatchiyah, JB-UB daf-19 Binding Sites in C. elegans GTTGTCATGGTGAC GTTTCCATGGAAAC GCTACCATGGCAAC GTTACCATAGTAAC GTTTCCATGGTAAC che-2 daf-19 osm-1 osm-6 F02D8.3 -150 source: Peter Swoboda

18. 9/17/2015fatchiyah, JB-UB Splice Motifs in A/T rich Organisms

19. 9/17/2015fatchiyah, JB-UB Motif Representing Consensus sequence: a single string with the most likely sequence(+/- wildcards) Consensus sequence: a single string with the most likely sequence(+/- wildcards) Regular expression: a string with wildcards, constrained selection Regular expression: a string with wildcards, constrained selection Profile: a list of the letter frequencies at each position Profile: a list of the letter frequencies at each position Sequence Logo: Sequence Logo: –graphical depiction of a profile –conservation of elements in a motif.

20. 9/17/2015fatchiyah, JB-UB Motif Logos: an Example (http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html)

21. 9/17/2015fatchiyah, JB-UB Finding Regulatory Motifs Given a collection of genes with common expression, Find the (TF-binding) motif in common...

22. 9/17/2015fatchiyah, JB-UB An Example: Hormonal Gene Regulation To understand the cellular mechanisms of hormonal (hydrophobic and Hydrophilic) gene regulation To understand the cellular mechanisms of hormonal (hydrophobic and Hydrophilic) gene regulation

23. 9/17/2015fatchiyah, JB-UB Hormonal Gene regulation OBJECTIVES: OBJECTIVES: Describe basic mechanisms of gene regulation. Describe basic mechanisms of gene regulation. Describe gene regulation at transcriptional level. Describe gene regulation at transcriptional level. Describe key elements present in the region of gene involved in gene transcription. Describe key elements present in the region of gene involved in gene transcription. Give a definition of Promoters, enhancers, Response elements, Transcription factors and co-activators. Give a definition of Promoters, enhancers, Response elements, Transcription factors and co-activators. Aware that hydrophobic hormone receptor is a transcription factor. Aware that hydrophobic hormone receptor is a transcription factor. Describe basic organisation of steroid receptor molecule Describe basic organisation of steroid receptor molecule Describe how hydrophobic hormones regulate gene expression Describe how hydrophobic hormones regulate gene expression Describe how hydrophilic hormones regulate gene expression via cellular signalling molecules. Describe how hydrophilic hormones regulate gene expression via cellular signalling molecules.

24. 9/17/2015fatchiyah, JB-UB Regulation at Transcriptional level Transcription by tissue specific factors: muscle cell specific transporter factor(myoD)- in myoblasts. Ker1=keratinocyte differentiating factor-skin cells. HNF-5=hepatic nuclear factor5- liver cells Transcription by tissue specific factors: muscle cell specific transporter factor(myoD)- in myoblasts. Ker1=keratinocyte differentiating factor-skin cells. HNF-5=hepatic nuclear factor5- liver cells Hormone, growth factor or cellular messenger binding to response element: glucocorticoid response element (GRE): binds glucocorticoid receptor complex Hormone, growth factor or cellular messenger binding to response element: glucocorticoid response element (GRE): binds glucocorticoid receptor complex Alternative promoter: dystrophin gene Alternative promoter: dystrophin gene

25. 9/17/2015fatchiyah, JB-UB Promoter Regions tgacgcacacgtggggcggccatt -100 tata -35 Exon1Exon2 Many factor sites: c-fos, c-jun, c-myc/mac; Sp1, CREB, etc CREB C-myc/ max Sp-1C/EBP RNA Pol II TF II-B TF II-A TF II-D Transcription ON mRNA Protein

26. 9/17/2015fatchiyah, JB-UB Transcriptional regulation cis-acting transcriptional control cis-acting transcriptional control sequences: Promoter, Response elements; Enhancers, silencer sequences: Promoter, Response elements; Enhancers, silencer Transcription regulatory proteins (Transcription factors) ·

27. 9/17/2015fatchiyah, JB-UB Cis acting transcriptional control sequences Promoters: Promoters: Located in the immediate upstream region, serves to initiate transcription. Located in the immediate upstream region, serves to initiate transcription. Consists of combination of short sequence elements (ccaat box, tata box, gc box). Consists of combination of short sequence elements (ccaat box, tata box, gc box). Recognised by ubiquitous transcription factors. Recognised by ubiquitous transcription factors. Promoters of gene that show tissue specific expression pattern often include cis-acting sequence elements that can be recognised by tissue specific transcription factors. Promoters of gene that show tissue specific expression pattern often include cis-acting sequence elements that can be recognised by tissue specific transcription factors.

28. 9/17/2015fatchiyah, JB-UB Cis acting transcriptional control sequences Response elements: Response elements: Found in selected genes whose expression is controlled by an external factor. Located short distance upstream of promoters. Found in selected genes whose expression is controlled by an external factor. Located short distance upstream of promoters.

29. 9/17/2015fatchiyah, JB-UB Cis acting transcriptional control sequences Enhancers: Enhancers: Positive regulatory elements, function independent of both orientation and distance from the genes they regulate. They contain elements recognised by ubiquitous transcription factors and tissue specific transcription factors. Positive regulatory elements, function independent of both orientation and distance from the genes they regulate. They contain elements recognised by ubiquitous transcription factors and tissue specific transcription factors. Silencers: negatively regulatory elements. negatively regulatory elements.

30. 9/17/2015fatchiyah, JB-UB Transcriptional regulatory proteins (Transcription factors) Transcription is regulated by a large number of DNA binding proteins. Transcription is regulated by a large number of DNA binding proteins. These DNA binding proteins mostly bind the response elements in a dimeric form, either as homodimers or or as heterodimers. These DNA binding proteins mostly bind the response elements in a dimeric form, either as homodimers or or as heterodimers. The symmetry of these dimeric transcription factor is matched by their response elements which frequently posses an incomplete dyad symmetry. The symmetry of these dimeric transcription factor is matched by their response elements which frequently posses an incomplete dyad symmetry.

31. 9/17/2015fatchiyah, JB-UB Structural motifs of the regulatory DNA binding protein Helix-turn-helix (HTH) motif: mediated DNA binding by fitting into major groove of the DNA helix, allowing precise alignment of the factor in relation to DNA sequence recognised Helix-turn-helix (HTH) motif: mediated DNA binding by fitting into major groove of the DNA helix, allowing precise alignment of the factor in relation to DNA sequence recognised Helix –loop helix: promotes both DNA binding and protein dimer formation. Helix –loop helix: promotes both DNA binding and protein dimer formation. Zinc Finger: loops or fingers of amino acids that have a zinc ion at their core. The adjacent amino acid sequences form a α-helices that makes contact with DNA in the major groove Zinc Finger: loops or fingers of amino acids that have a zinc ion at their core. The adjacent amino acid sequences form a α-helices that makes contact with DNA in the major groove Leucine Zipper: forms a dimer that grips the DNAdouble helix like a peg, by inserting into the major groove. Leucine Zipper: forms a dimer that grips the DNAdouble helix like a peg, by inserting into the major groove.

32. 9/17/2015fatchiyah, JB-UB DNA binding motifs in Proteins

33. 9/17/2015fatchiyah, JB-UB Properties of dimeric transcription factors. DNA binding module: Provides a non-selective affinity for DNA and the ability to recognise the specific base sequence of the response element. DNA binding module: Provides a non-selective affinity for DNA and the ability to recognise the specific base sequence of the response element. A dimerisation module allows protein to form an active dimeric state. A dimerisation module allows protein to form an active dimeric state. Transcription activation (or inhibition) region: required for stimulation or inhibition of transcription Transcription activation (or inhibition) region: required for stimulation or inhibition of transcription

34. 9/17/2015fatchiyah, JB-UB Regulation of transcription factors Level of synthesis Level of synthesis Covalent modification by phosphorylation /desphosphorylation Covalent modification by phosphorylation /desphosphorylation Binding of small molecules can act as positive or negative allosteric effectors Binding of small molecules can act as positive or negative allosteric effectors

35. 9/17/2015fatchiyah, JB-UB Specific transcription factors Tissue specific gene expression Tissue specific gene expression Cell growth and differentiation Cell growth and differentiation Response to lipid soluble hormones and second messenger molecules Response to lipid soluble hormones and second messenger molecules Cellular transcription factors required for the transcription of viral gene. Cellular transcription factors required for the transcription of viral gene.

36. 9/17/2015fatchiyah, JB-UB Specific Hormonal Gene regulation Hormones regulate the function of their target cells by receptor mediated pathways. Hormones regulate the function of their target cells by receptor mediated pathways. Water soluble hormones for which the lipid barrier of the plasma membrane is impenetrable, interact with their receptors at the cell surface Water soluble hormones for which the lipid barrier of the plasma membrane is impenetrable, interact with their receptors at the cell surface Hydrophobic hormones that are lipid soluble and therefore can pass the cell membrane interact with another family of receptors that are intracellular (cytosolic or nuclear). These intracellular receptors function as hormone-regulated transcription factors, controlling the expression of specific target genes by interacting with regions known as hormone response elements located close to the promoter in the regulatory region Hydrophobic hormones that are lipid soluble and therefore can pass the cell membrane interact with another family of receptors that are intracellular (cytosolic or nuclear). These intracellular receptors function as hormone-regulated transcription factors, controlling the expression of specific target genes by interacting with regions known as hormone response elements located close to the promoter in the regulatory region

37. 9/17/2015fatchiyah, JB-UB Receptor-mediated induction of gene transcription by steroid hormones Activated receptors Coactivator protein(s) hsp90 Pre-initiation complex RNA Pol-II + GTFs TATA box HRE Steroid ligands Vacant Receptor

38. 9/17/2015fatchiyah, JB-UB Mechanism of gene activation by the steroid hormone receptors (transcription factors) The DNA binding domain is characterised by the presence of two zinc fingers. The DNA binding domain is characterised by the presence of two zinc fingers. In the case of steroid hormones Zinc is co- ordinated by four cysteine residues. In the case of steroid hormones Zinc is co- ordinated by four cysteine residues. In other Zinc fingers Zn can be co-ordinated by two histidine and two cysteine residues. In other Zinc fingers Zn can be co-ordinated by two histidine and two cysteine residues. Although these are referred to as fingers, the tertiary structure is more like a fist made from beta sheet and α helical structure. DNA interacting residues are found in the α-helical part of the molecule. Although these are referred to as fingers, the tertiary structure is more like a fist made from beta sheet and α helical structure. DNA interacting residues are found in the α-helical part of the molecule.

39. 9/17/2015fatchiyah, JB-UB Mechanism of gene regulation by Hydrophilic hormones Intracellular second messenger cAMP and gene regulation. In the previous lecture you learnt that cAMP is produced as a result of activation of adenylate cyclase by G protein which in turn had been acivated by hormone which can not pass the hydrophobic cell membrane. In the previous lecture you learnt that cAMP is produced as a result of activation of adenylate cyclase by G protein which in turn had been acivated by hormone which can not pass the hydrophobic cell membrane. This cAMP in turn acivates a cAMP depedent protein kinase (PKA) which modulates multiple aspects of cell function. PKA phosphorylates a transcription factor called CREB (cAMP response element binding protein). This cAMP in turn acivates a cAMP depedent protein kinase (PKA) which modulates multiple aspects of cell function. PKA phosphorylates a transcription factor called CREB (cAMP response element binding protein). This is then translocated to the nucleus where it binds to a short pallinodromic sequence in the promoter region of cyclic AMP-regulated genes referred to as CRE. This is then translocated to the nucleus where it binds to a short pallinodromic sequence in the promoter region of cyclic AMP-regulated genes referred to as CRE.

40. 9/17/2015fatchiyah, JB-UB Thank You