1. A Primer on and Application of Competitive Dynamics Walter Ferrier, Ph.D. Gatton College of Business & Economics University of Kentucky Presented at Helsinki School of Economics March 2008

2. Page 2 Coke’s Strategic Actions Pepsi’s Strategic Actions Rivalry Competitive Outcomes Industry Characteristics Organizational Characteristics

3. Page 3 Karjala Lapin Kulta Lapin Kulta Observable … Relative … Dynamic

4. Page 4 Dethronement of the Shoe Leader Market Share (U.S.) 1980 1990 2005 Adidas Nike Reebok

5. Page 5 Dethronement of the Retailing Leader MarketShare 1950 1960 1970 1980 1990 2000 Wal-Mart Sears JC Penney

6. Page 6 Dethronement of the Aircraft Leader Market Share 1950 1960 1970 1980 1990 2000 McDonnell- Douglass Boeing Airbus

7. Page 7 Organizational Factors Industry Factors Relational and Institutional Context Action Awareness Motivation Capability Performance An Emerging Theory of Competitive Dynamics? The Awareness-Motivation-Capability (AMC) Perspective

8. Page 8 What is Competitive Dynamics? …a paradigm …a theory …a pre-theory …a view …a reasoning …a lens …a method –Research design element –Observational mechanism –Measurement technique

9. Page 9 Integrated/Contributing Theories Info processing Social networks Managerial cognition Multi-market competition Prospect/Threat rigidity First-mover Institutional theory Complexity Communication Knowledge Signaling Resource-based view Real option theory Game theory Strategic groups Structure-conduct-perform. Dynamic limit pricing Austrian economics Corporate entrepreneurship Dominant firm/Oligopoly Force field (from psychology) Population ecology

10. Page 10 What do they explain? –Competitive behavior? –…its antecedents, contexts? –…processes? Does competitive dynamics “enable” other theories explain, observe, conceptualize, measure: –“behavior” –“competition” –“events” –“dynamic interactive processes” –“change” –other things? Integrated/Contributing Theories

11. Page 11 Actor relativity/interdependence The firm relative to: –Itself (over time) –Dyadic partners –Groups –Industry members –Other non-rivals On factors/dimensions such as: –Competitive actions –Resources/capabilities –Firm characteristics –Outcomes A Pre-Theory of Competitive Inter-Action: Some Boundary Conditions

12. Page 12 Competitive “action” as fundamental element “…a visible, externally-directed competitive move carried out to improve a firm’s relative competitive position” Dynamic Explicitly accounts for: – Time – Change – Evolution – Contingencies – Processes Pre-Theory of Competitive Inter-Action

13. Page 13 Has impact/consequences on: Performance –Relative –Absolute Behavior of other firms Supply chain members –Customers –Suppliers Regulators Investors Society Pre-Theory of Competitive Inter-Action

14. Page 14 Other Uncertainty, unknowability Imperfect information Thought, intent, purpose Not costless Pre-Theory of Competitive Inter-Action

15. Page 15 Awareness Alertness - attention Vision Scanning Filtering Motivation Intention Valence Emotion Desire Capability Organizational enablers/constraints Contextual enablers/constraints Theoretical Scaffolding/Fulcrum Theoretical Integration Required: “Other theories” support and explain logic when integrated with this AMC theoretical scaffolding – e.g.: Behavioral theory of the firm Institutional theory Social network theory RBV

16. Page 16 Awareness Motivation Capability Firm 1 Strategy Firm 2 Strategy Competitive Inter-Action Organizational Drivers Industry Structure Drivers Institutional Drivers Socio- Relational Drivers Other? Performance Cognitive Drivers An Emerging Theory of Competitive Dynamics

17. Page 17 Levels of Analysis Firm Finnair

18. Page 18 Levels of Analysis FirmDyad Finnair SAS

19. Page 19 Levels of Analysis FirmDyad Triad Finnair Blue 1 FinnairSAS FinnairSAS

20. Page 20 Levels of Analysis FirmDyad Triad Network Finnair Lufthansa Blue 1 US Airways Virgin FinnairSAS FinnairSAS Finnair KLM

21. Page 21 Levels of Analysis FirmDyad Triad GroupNetwork Finnair Lufthansa Blue 1 US Airways Virgin FinnairSAS FinnairSAS Finnair KLM Lufthansa Brussels Air France KLM Blue 1 SAS Ryanair eos

22. Page 22 Levels of Analysis FirmDyad Triad GroupNetwork Industry (or Population) Finnair Lufthansa Blue 1 US Airways Virgin FinnairSAS FinnairSAS Finnair KLM Lufthansa Brussels Air France KLM Blue 1 SAS Ryanair Finnair Virgin KLM Lufthansa US Airways Ryanair British Airways Alitalia eos

23. Page 23 Levels of Aggregation New Product Introduction Individual Action (or response)

24. Page 24 Levels of Aggregation Ad Campaign New Product Introduction Price Cut Individual Action (or response) Action-Response Dyad

25. Page 25 Levels of Aggregation Ad Campaign New Product Introduction Price Cut Individual Action (or response) Action-Response Dyad Competitive Repertoire 6 x Price 1 x Product 4 x Ads 2 x Signaling 1 x Law Suit

26. Page 26 Levels of Aggregation Ad Campaign New Product Introduction Price Cut Individual Action (or response) Action-Response Dyad Competitive Repertoire 6 x Price 1 x Product 4 x Ads 2 x Signaling 1 x Law Suit time Ad Product Price Ad Price Competitive Attack SignalLegalPrice Coke Pepsi Product attack counter attack

27. Page 27 Network Evolution, Competitive Actions and Performance Mkt ProdPrice Mkt PriceProd Price Focal Firm A B C D E t1t1 t2t2 t3t3 Focal Firm A B C Focal Firm A B Performance time Actions

28. Page 28 Network Evolution, Competitive Actions and Performance Mkt ProdPrice Mkt PriceProd Price Focal Firm A B C D E t1t1 t2t2 t3t3 Focal Firm A B C Focal Firm A B Performance time Actions

29. Page 29 Network Evolution, Competitive Actions and Performance Mkt ProdPrice Mkt PriceProd Price Focal Firm A B C D E t1t1 t2t2 t3t3 Focal Firm A B C Focal Firm A B Performance time Actions

30. Page 30 Globalization, Competitive Action and Performance Mkt ProdPrice Mkt PriceProd Price Focal Firm A B C D E t1t1 t2t2 t3t3 Focal Firm A B C Focal Firm A B Performance time Actions Think of internationalization and globalization in this way

31. Page 31 What is the next “big thing”? Phenomena Constructs Measures Levels of analysis or aggregation Data Unobservables Analytical techniques Theory

32. Page 32 Non-Organizational/Economic Theories Physics Physical Optical Quantum mechanics Biology Molecular/DNA Virology Medicine Neurology Psychiatry Kinesiology Music Perception/appreciation Composition theory Experimental aesthetics Perception Interpretation Subjective judgment

33. Page 33 What is Competitive Dynamics? Coaching a basketball game Training a hunting dog Conversation/argument between husband & wife Phenomenon AZ K time Rivalry: Airbus vs. Boeing Negotiating a raise Writing an operatic duet

34. Page 34 Competitive Dynamics: Instrumentality, Application and Theory An (any?) open-system process that: Is interactive –Contains multiple actors –Behavior and outcomes relative among actors Contains distinct, observable elements, events, or happenings Contains some perceptual and actual uncertainty or unknowability Requires some thought, intent, purposefulness on behalf of actors Is not costless

35. Page 35 Questions or Comments

36. The Fast and the Furious: The Assignment of Stock Risk Based on Investor Perceptions of Competitive Maneuvering and Who’s in the Drivers’ Seat

37. Page 37 Focal Firm Actions Focal Firm Performance Rivals’ Performance Dynamic Competitive Interaction Investment Community Dynamic- Subjective Interpretation and Valuation of… Stock Risk & Returns Rivals’ Actions Traditional-Objective Valuation Process TMT Who’s making it happen? What’s happening?

38. Page 38 Focal Firm Actions Focal Firm Performance Empirical Model Rivals’ Actions TMT Heterogeneity beta Industry Characteristics X

39. Page 39 Subjective Valuation of the Top Management Team Demographic diversity among TMT members serves as a signal for: – Cognitive/experiential breadth – Decision quality/comprehensiveness – Environmental scanning – Legitimacy/reputation …and for: – Interpersonal conflict/dysfunction – Slow decision speed – Lack of agreement-seeking/consensus

40. Page 40 Subjective Valuation of Competitive Strategy Interpretation and valuation related to perceptions of collative structure in the pattern of competitive behaviors: – Simplicity… complexity – Predictability… unpredictability – Conformity … non-conforming – Long duration … single blip

41. Page 41 Perceptions of Gestalts in Sensory Information Gestalt psych. Simplicity Proximity Similarity Common direction Exp. aesthetics Simplicity Familiarity Predictability Orderly Stability Comp. dynamics Simplicity Conformity Predictability Duration Outcomes Recognition of Gestalts or ‘wholes’ Subjective judgment; hedonic value…”pleasingness” Subjective judgment of strategy-performance relationship

42. Page 42 Pattern Recognition, Interpretive Certitude and Hedonic Value “Sensory information” organized into meaningful wholes…Gestalts Computer screen pixels Paintbrush strokes Musical notes DNA nucleotides Pitch sequence etc.

43. Page 43 Hypotheses Investors will assign higher levels of stock risk to firms with heterogenous TMTs that carry out competitive attacks that are perceived as being: – Simple – Predictable – Conforming – Significant duration

44. Page 44 Sensory Information: Competitive Actions Pricing Marketing New Product Service Capacity Overt Signals cdbe a

45. Page 45 Competitive Action Sequences Ordered sample of “things” ‘Orderliness’ among elements (alphabet) – Logically unified sequence – Succession of market-based decisions – Patterns in stream of behaviors – Coordinated series of actions – Actions in a sequential strategic thrust COMPETITIVE ATTACK: An uninterrupted series/sequence of competitive actions cdbe a

46. Coke’s Actions Pepsi’s Action Rivalry Competitive Outcomes Industry Characteristics Organizational Characteristics da bec da bec

47. Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Coca-Cola Pepsi Action-Reaction Dyads bbba acce

48. Prior Studies: Action “Repertoires” time Year-End Tallies Coca-Cola Pepsi bbb c b ba ce b

49. Sequence of Competitive Actions time MKT PRICEMKTPRICESVCPROD Sequence of Musical Notes Music as Metaphor for Competitive Behavior

50. Page 50 Notes Pitch Volume Dynamics Duration Voice Like individual competitive actions

51. Page 51 Chords, Arpeggios Harmonic anchor Harmonic interval or proximity Harmonic sequence Like pairs or combinations of competitive actions

52. Page 52 Melody Timing, rhythm Simplicity Movement Predictability Familiarity Phrasing Motif Like a meaningful, coherent series of competitive actions

53. Page 53 Notes Pitch Volume Dynamics Duration Voice Chords, Arpeggios Harmonic anchor Harmonic proximity Harmonic sequence Melody Timing, rhythm Simplicity Movement Predictability Familiarity Phrasing Motif Music as metaphor for competitive behavior

54. Sequences LANGUAGE: BOXING: DNA: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. Jab...Jab…Uppercut CAGTACATAGTACGATACGA MUSIC: COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run;

55. Page 55 a b c d e cabecabdecabd CokePepsi d aa b e c e b a d b cc Observed Sequence Competitive Actions Over Time = Attack

56. Page 56 Sequence Analysis WinPhaser (…thanks to Tim Pollock & Michael Holmes) – Optimal matching analysis Measures the similarity/difference between two sequences via insertions, deletions, substitutions

57. Page 57 Total a b c d e cab d acaadceaad cc a a e a d b aaaa 7 1 1 2 2 Observed Sequence of Competitive Actions Competitive Attack Simplicity

58. Page 58 Total a b c d e eab d acacdecbdd e c d a cc d b b a e a 3 2 2 3 3 Observed Sequence of Competitive Actions Competitive Attack Complexity

59. Page 59 a b c d e caeecabdecabd d e aaa d b b e cc c Focal Firm in time 1 Focal Firm in time 2 b Observed Sequence Competitive Attack Predictability

60. Page 60 a b c d e cabecabdecabd Focal Firm in time 1 d e b aaa d b b e c c c Focal Firm in time 2 Observed Sequence Competitive Attack Unpredictability

61. Page 61 a b c d e cab e cabdecabd Focal Firm d aa b e c e b a d b c c Observed Sequence Competitive Attack Conformity Industry Norm

62. Page 62 a b c d e cabecabdecabd Focal FirmIndustry Norm d aa b e c e b a d b cc Observed Sequence Competitive Attack Non-Conformity

63. Page 63 a b c d e eabacadecd e c d a c d b a e a Observed Sequence of Competitive Actions Competitive Attack [Long] Duration time

64. Page 64 a b c d e acdc c a c d Observed Sequence of Competitive Actions Competitive Attack [Short] Duration time

65. Page 65 a b c d e cab d ecabdecabd e c b a c b d b a e c a Observed Sequence of Coke’s Competitive Actions Coke Strategic Chunking

66. Page 66 a b c d e cab d ecabdecabd e c b aaa d bb e cc Observed Sequence of Pepsi’s Competitive Actions Pepsi Strategic Disconnectedness

67. Page 67 ( + )1.0 ----------------------------------------------------------------------------------- (-)1.0 a b c d e cabecabdecabd a Observed Sequence of Competitive Actions Coke Strategic Motif – High Variance of Precedence Scores c d b e

68. Page 68 ( + )1.0 ------------------------------------------------------------ (-)1.0 a b c d e cabecabdecabd a Observed Sequence of Competitive Actions Pepsi Strategic Randomness – Low Variance of Precedence Scores c b d e

69. Page 69 Hypotheses Investors will assign higher levels of stock risk to firms with heterogenous TMTs that carry out competitive attacks that are perceived as being: – Simple – Predictable – Conforming – Significant duration

70. Page 70 Sample and Data Sources All Fortune 500 Members who were: Top two in market share (1987-1993) Undiversified (i.e. single or dominant business) – 35 different industries over 7 years – 490 firm-years Competitive Actions News, Press Releases from F&S Predicasts TMT Demographics Dun & Bradstreet Industry and Firm Financial Data Compustat

71. Page 71 Analysis Structural Equations Model –Five-indicator model for TMT Heterogeneity –Median split -- Best SEM model fit for low TMT Heterogeneity condition Educational background Functional background Industry background Attendance at elite schools Military experience

72. “Moderated-Effects” SEM Results : Attack Characteristics in Low TMT Hetero Condition beta Strong Collative Properties Duration Predictability Simplicity Weak Collative Properties Conformity

73. “Moderated-Effects” SEM Results : Attack Characteristics in Low TMT Hetero Condition beta Strong Collative Properties Duration Predictability Simplicity Weak Collative Properties Conformity Support Opposite

74. Page 74 Conclusions Human capital (TMT) and behavioral capital (competitive maneuvering) are important components of risk assessment Collative properties of competitive strategy: … increase interpretability and valuation of competitive strategy… …but attenuated by perceptions of TMT processes and capabilities Simplicity Predictability Conformity Duration Cognitive breadth Decision comprehensiveness Interpersonal conflict Slow decision-making

75. Page 75 Questions or Comments

76. The Influence of Verbal Exchange among TMT Members on Decision Quality and Innovation

77. Page 77 Extant Research TMT Members Performance Group Cohesion Group Dysfunction Agreement- seeking Debate Constructive Conflict Decision Comprehensive- ness Strategic Consensus Decision Speed Strategic Change Competitive Dynamics Innovation

78. Page 78 TMT Members Performance Group Cohesion Group Dysfunction Agreement- seeking Debate Constructive Conflict Decision Comprehensive- ness Strategic Consensus Decision Speed Strategic Change Competitive Dynamics Innovation Conversation Analysis

79. Page 79 “The Decision Funnel” Inputs and Processes Presumed by TMT Demographic Proxies Decision Outcomes Decision Process Raw Decision Inputs Field of Vision

80. Page 80 Tunnel Vision: Homogenous TMT – Industry Background Decision Outcomes Decision Process Raw Decision Inputs Field of Vision

81. Page 81 Dysfunction: Interpersonal Conflict – Poor Social Cohesion Decision Outcomes Decision Process Raw Decision Inputs Field of Vision

82. Page 82 Constructive Conflict: Cognitive/Experiential Breadth + DA/DI Decision Outcomes Decision Process Raw Decision Inputs Field of Vision

83. Page 83 Decision Process in Real-Time Decision Outcomes Decision Process Raw Decision Inputs Field of Vision

84. Page 84 Decision Process in Real-Time Conversational, verbal statements uttered in group decision-making sessions

85. Page 85 Pilot Study MBA New Product Development Simulation Student Teams (3 for now) – 5-7 members each – Experiential & functional diversity Strategic, Multifunctional Task – Build “New Car” – 3 hours – Strategic position vs. other teams – Product features – Marketing – Assemble and test prototype Audio Transcript of Decision Session – Coded into different verbal statements

86. Page 86 Preliminary Categories of Verbal Statements NEW - New Idea/Concept Statement “Based on the marketing reports, I think we should offer a really big luggage compartment.” EXT - Idea/Concept Advocacy/Extension “ Oh, yea. We can cut manufacturing costs even more by outsourcing almost all our parts [production].” INQ - Idea/Concept Inquiry “ What do you mean by customer-driven design?” CHAL - Idea/Concept Challenge “I just don’t get it. Why would customers care about dealer margin?” DEF - Idea/Concept Defense “Well, if you think the other companies are going to do the same thing, then we should stick with being different.”

87. Page 87 ACQ - Idea/Concept Acquiescence “I guess. Maybe we can’t really get the car to do all that in a 5-minute demonstration.” VAL - Idea/Challenge Validation Statement “I don’t know about you, but I think we should go ahead with a big luggage rack.” TRAN - Transitional Statement “Can we talk about how to get this done before 3:00 p.m.?” AGR - Agreement-seeking Statement “Anybody else wanna go for this?”

88. Page 88 REA – Task/Process Reassurance Statement “We’ll get the numbers when you need them.” “I think we’re on the right track.” CRIT – Task/Process Criticism/Doubt “There’s no way the audience will see these all little parts.” “If we can’t decide by 2:45, then let’s bag it.” HUM – Humor “How many MBAs does it take to build a Lego car?” SMALL - Task- or Process-related Small Talk “This is a pretty cool steering program.” “I can’t wait to see what the other guys have.”

89. Page 89 ‘Alphabet’ of Verbal Statements NEW – New idea CHAL – Challenge of idea AGR – Agreement with idea SMALL – Small talk VAL – Validation of idea DEF – Defense of idea HUM - Humor cdbe a

90. Page 90 Sequence Analysis WinPhaser – Gamma analysis – Separation score Measures the extent to which a given element of a sequence is temporally, ordinally, or spatially ‘isolated’ from other elements vs. whether it is ‘near’ other elements – Gamma analysis – Precedence score Measures the extent to which a given element of a sequence is ‘precedes’ other elements vs. whether it is ‘follows’ other elements – Optimal matching analysis Measures the similarity/difference between two sequences via insertions, deletions, substitutions

91. Page 91 Total a b c d e eab d acacdecbdd e c d a cc d b b a e a 3 2 2 3 3 Observed Sequence of Verbal Statements Conversation Complexity – Low Herfindahl Index

92. Page 92 Total a b c d e cab d acacdceaad cc a a e c d b a a c a 5 1 1 2 4 Observed Sequence of Verbal Statements Conversation Simplicity – High Herfindahl Index

93. Page 93 a b c d e cabecabdecabd Focal Team Decision Phase 1 d e b aaa d b b e c c c Focal Team Decision Phase 2 Observed Sequence Conversation Unpredictability – High Distance Scores

94. Page 94 a b c d e cabecabdecabd d e aaa d b b e cc c b Observed Sequence Conversation Predictability – Low Distance Scores Focal Team Decision Phase 1 Focal Team Decision Phase 2

95. Page 95 a b c d e cabecabdecabd Focal TeamIndustry Norm d aa b e c e b a d b cc Observed Sequence Conversation Non-Conformity – High Distance Scores

96. Page 96 a b c d e cab e cabdecabd Focal Firm d aa b e c e b a d b c c Observed Sequence Conversation Conformity – Low Distance Scores Rival Teams

97. Page 97 a b c d e cab d ecabdecabd e c b a c b d b a e c a Observed Sequence of Verbal Statements Conversation Chunking – Low Separation Scores

98. Page 98 a b c d e cab d ecabdecabd e c b aaa d bb e cc Observed Sequence of Verbal Statements Conversation Disconnectedness – High Separation Scores

99. Page 99 ( + )1.0 ------------------------------------------------------------ (-)1.0 a b c d e cab d ecabdecabd e c b a Observed Sequence of Verbal Statements Conversation Randomness – Low Variance of Precedence Scores

100. Page 100 ( + )1.0 -------------------------------------------------------------------------------------- (-)1.0 a b c d e cab d ecabdecabd e c b a Observed Sequence of Verbal Statements Conversation Motif – High Variance of Precedence Scores

101. Page 101 Other Dimensions of Verbal Statements Task- vs. Interpersonal-directed Task Relatedness/Relevance Statement Complexity (number of distinct ideas within statement) Scope (the breadth of total task addressed by statement) Statement Duration Tone (directive/confident, condescending, worrisome, etc.)

102. Page 102 Decision Process in Real-Time Conversation Phase Predictability Conversation Complexity Conversation Motif Conversation Chunking

103. Propositions Innovation & Creativity Conversational Sequence Characteristics Conversation Complexity Conversation Chunking Conversation Motif Conversation Unpredictability High Low

104. Page 104 Moderated Mediation Model Conversational Structure PerformanceInnovation TMT Composition- Demographics- Processes

105. Page 105 Food for thought… Sequence of decision “process” matters – Decision phases – Dynamic dimensionality – Potential impact on decision quality and innovation Verbal exchange as informative level of analysis – Verbal statements as fundamental decision points Artifactual data with qualitative flavor Avoid self-report bias – Group-level construct/measure Avoid multi-level problems (i.e., aggregating TMT demographics or questionnaire scales)

106. Page 106 Dynamic Event Sequencing “Event” coding, phasing, and sequencing technique used for other organizational processes –Resource acquisition or allocation events –Inter-organizational alliances events –New product development phases –Globalizing or internationalizing events Explore link between patterns in a variety of organizational processes and patterns of behavior cdbe a xywzv Competitive Behavior Organizational Processes

107. Page 107 Questions or Comments

108. Page 108 Thank you