1. DNA TECHNOLOGY Transgenic organism Restriction Enzyme
GMO = genetically modified organism
Gene therapy
Vector
Recombinant DNA
PCR (polymerase chain reaction)
Gel Electrophoresis
Cloning
Stem cells

2. Transgenic Organisms What are they?
Organisms that carry genes from another species
The first transgenic organisms were bacteria
First transgenic animal happened in 1975
A mouse carried an ape gene +

3. How in the world did that happen?!
First you find the gene that
you want to transfer over
Then you must cut that gene out of the parent DNA
The area you want to put the DNA
in the other organism has to be found
Cut the new DNA so you can insert into vector
Gene put into its new DNA home

4. Different restriction enzymes cut DNA at different palindromes

5. How does the cut piece of DNA get into the targeted organisms cells?
How do you cut the DNA?
Use restriction enzymes: Bacterial proteins that have the ability to cut strands of DNA at a specific nucleotide sequence.
How does the cut piece of DNA get into the targeted organisms cells?
For animals:
Transgene put into a vector and then into a fertilized egg
For Plants:
Transgene put into vector which is put into a bacterium that infects plant cells.

6. Gene you want. Makes Human insulin Cut out by restriction enzymes
GGAATTCCTTAAGTCAACCGCTTAAGG
Gene you want. Makes Human insulin
GGAATTCCTTAAGTCAACCGCTTAAGG
Cut out by restriction enzymes
GTACTGACCCTTGGTA AGAGTACGTTTGT
DNA inside vector cut with restriction enzymes

7. What the heck is a vector?
A Vector is a Virus that has been re-engineered
A new piece of DNA has been added to the virus and often times the part of DNA that infects you is removed.
Transgene

8. Transgene put into vector DNA
GTACTGACCCTTGGTA AGAGTACGTTTGT
TTAAGTCAA
Egg put into mother and when baby cow is born it makes human insulin
Vector infects egg
Vector puts Transgene
into egg DNA

9. Vectors Example: plasmid (small ring of DNA in a bacterial cell
May be biological (viruses or plasmids)
Or mechanical (micropipette or “bullet”

10. So why don’t we make all kinds of new animals and plants?
We don’t know how it will affect our environment
If something is wrong with them its not like we can just take them all back up
What other effects will it have besides the one intended
They can mutate
Examples of GMOs (genetically modified organisms) that we have now………
Sterile male crop pests
Plants that have an insecticide in them

11. Gene Therapy What in the world is gene therapy?!?!
The treatment of certain disorders, especially genetic disorders, by introducing specific engineered genes into a patient's cells
Several methods can be used when treating a genetic disorder:
A normal gene may be inserted into a nonspecific location within the genome to replace a nonfunctional gene. This approach is most common. An abnormal gene could be swapped for a normal gene. The abnormal gene could be repaired, which returns the gene to its normal function. The regulation (the degree to which a gene is turned on or off) of a particular gene could be altered

12. So how do we do this?
A vector is used to deliver the DNA needed to fix the problem into the target cells……the ones that need to be fixed.
Just like in transgenic organisms the vector infects the cells and delivers the DNA into the cell to be put into the target cell’s DNA
This new DNA changes the target cells so that they are now normal.
What kind of disorders are we talking about here?
Hemophilia
Sickle Cell Anemia
Cystic Fibrosis
Huntington’s Disease
Thalassaemia

13. So don’t we cure everybody?
FDA has not approved gene therapy because it has proven dangerous.
Not a permanent cure
Our bodies can have an immune response to the vector and DNA. Example of this is France.
Many diseases are caused by multi-gene problems

14. Gene Therapy Cell culture flask Cell culture flask Cell
Bone marrow cells
Hip bone

15. PCR: polymerase chain reaction
Replicates DNA outside of living organisms
Uses heat and enzymes to make lots of DNA very fast
Used for crime investigations, diagnose diseases (like HIV) and cloning

16. Recombinant DNA
Made by connecting (recombining) fragments of DNA from different sources

17. Uses of Recombinant DNA
Insect resistant crops
Growth hormones
Insulin for diabetics
Higher yielding food plants
Clotting factor for hemophiliacs
E. coli produces indigo dye to color jeans
Cheese, laundry detergents, and sewage treatment are enhanced by recombinant DNA

18. GEL ELECTROPHORESIS

19. Loading the well with DNA

20. Steps of Gel Electrophoresis:
Restriction enzymes cut DNA into fragments. The fragmented DNA is injected into wells in the gel. A current is sent through the gel and the fragments will move at different speeds that appear as bands under UV light. Bands can be matched up to identify criminals, bodies or fossils or to determine parentage. Longer fragments move slower than short ones.

21. Send a current through the gel

22. Fragments will move at different speeds, creating bands that appear under UV light

23. Bands can be matched up to identify parents, children, or criminals

25. Making an identical genetic copy
Cloning
Making an identical genetic copy
Dolly, 1997
News report

26. Stem Cells
Undifferentiated cells that can be genetically engineered to express the genes for any desired type of tissue
Usually embryonic = controversial
But is there another way…?
Often used in regenerative medicine
Current research hopes to treat diseases such as Parkinson's disease, Alzheimer's disease, spinal cord injury, heart disease, diabetes and arthritis.

28. Plasmid Activity: p. 355 in textbook
Write the letters on the LONG strip:
GGATCC GGATCC
CCTAGG CCTAGG
Write the letters on the SHORT strip:
GGATCC
CCTAGG
Make sure all letters are equally spaced

29. Plasmid activity p
Tape the ends of the shorter strip together.
This is the plasmid
Cut the longer strip of DNA in 2 places at the palindrome GIGATCC. This is the foreign DNA. Cutting it represents restriction enzymes.
Cut the plasmid in the same way.
Insert the foreign gene into the plasmid and tape together.