1. Clustered Repeats and Regulatory Sites Abdulrahman Alazemi, Shahroze Abbas, Liam Lewis, Donald Ta, Ann Vo

2. Overview Clustered repeats  Wide variety of functions  History largely unknown Regulatory Sites  A segment capable of altering expression of specific genes  Various classifications of regulatory sequences  Found in non-coding regions  Functions at the transcriptional level

3. Identification Consensus sequences  Utilize PSSM  How?  Determine consensus

4. Clustered repeats and potential regulatory sequences Abdulrahman Alazemi

5. Background; Transcription factors? Activators Vs Repressors.

6. Thoughts; - My questions; Can I apply a known method/tool with a known results to other phage and get the same/similar result?

7. The known case; Examine the proven Repressor and Cro binding sites (operators) of Phage Lambda. Bioinformatics method in the notes. First “Name of Lambda in BioBike”. Go to BioBike/Phantome.

8. The known case; Second; Motifs in for the upstream sequence of phage Lambda. Labeled, DNA, Multiple-Hits-ok.

9. The known case; Results of motifs in. More than one interesting case. Motifs 1, 2, 3.

10. The known case; BioBike function; Description-analysis submenu, Genes- proteins menu. Now, we have an idea about where to look.

11. The known case; Used the function sequence-of from Genome menu. Go to the specific region in the genome

12. The known case; Finding the operators. Directly Vs inversion of.

13. Phage Lambda map;

14. Thoughts; - My concern/focus; Would I find some sort of generality between operators of different phages?

15. My experiment; Twenty one random phages of different phage families. Eight of them don't have repressors. (eliminated) Three of the 13 phages left didn't display a map because of linear amplicon. Ten phages out of 21 went through all the steps of the method/tool successfully and gave me back out come that I can work with. Three out of 10 have similar results to phage Lambda.

16. Outcome analysis; - Similar to phage lambda: -Bacillus-phage-1

17. Phage Bacillus-phage-1 map;

18. Outcome analysis; -Similar to phage Lambda: -Listeria-phage-A006

19. Phage Listeria-phage-A006 map;

20. Outcome analysis; -Similar to phage lambda: -Lactobacillus-johnsonii- prophage-Lj928

21. Phage Lactobacillus-johnsonii-prophage-Lj928 map;

22. First conclusion; - Out of 21 or 10 phages, only 3 phages are similar to phage Lambda. - Less than 50%. - No Generality. - Appropriate conclusion; - Phage Lambda, Bacillus-phage-1, Listeria-phage-A006, and Lactobacillus-johnsonii-prophage-Lj928 have a similarity/generality between their operators that the repressors bind to.

23. Inspiration; - Dead end. - The articles !!!! - Extend my research. - look for something interesting.

24. First interesting case; - In Burkholderia-phage-Bcep1. - Six similar sequence in one intergenic region - another 6 similar sequences in another intergenic region. - Palindromic sequences. - 6 or 3 sequences ? - Bacillus-phage-1 is similar to Burkholderia-phage-Bcep1 somehow.

25. First interesting case;

26. Phage Burkholderia-phage-Bcep1 map;

27. Second interesting case; - In phage Clostridium-phage-39-O. - Eight nucleotides sequence (TTACTACA) repeated 10 times in one intergenic sequence. - Again the same sequence repeated 8 times in another intergenic sequence in another place on the phage.

28. Second interesting case;

29. Phage Clostridium-phage-39-O map;

30. Conclusion; - Goals; - Pick one interesting case. - Research it. - Make sense of it.

31. A. Comparison of Pseudomonas putida and Azotobacter REP sequences Donald Ta

32. REPs Repetitive Extragenic Palindromic Sequences  Found mainly in abundance in Enterobacteriaecae Can be anywhere around 20 to 40 nt long Clustered into structures called BIMEs (bacterial interspersed mosaic element) as two inverted tandem repeats separated by a short linker of variable length

33. What do REPs do? Regulate Gene Expression Structuring DNA Specific target sites for bacterial insertion sequences Possibly more that are undiscovered

34. Previous Study I. Aranda-Olmedo 2002 used BLAST (Basic local alignment search tool) to find regions of local similarity between sequences downloaded from the National Center for Biotechnology Information (NCBI) Used database with all contigs of Pseudomonas putida already available in The Institute for Genome Research Developed their own program to screen all of the strains against the 35 nt sequence 5’- CCGGCCTCTTCGCGGGTAAGCCCGCTCCTACAGGG- 3’

35. Results of that Study

36. Implications from that study They suggest that the 35 bp element they found is species specific in P. putida First time that REP sequences have been described and characterized in a group of non- enterobacteriaceae

37. What am I doing? Comparing REP sequence element of Pseudomonas putida KT2440 with Azotobacter vanlandii  Why?  Order Pseudomonadales Used the REP element that is most common among Pseudomonas species “GCGGGnnnnCCCGC”

38. Methods Used built-in functions of BioBike to scan a sequence for possibly loose matches of a pattern “****GCGGG****CCCGC****” sequence iterated over the sequence of the organism of interest and then whenever there was a match it was displayed on the output “*” means an unspecified amino acid

39. Findings 52 sequence hits in Azotobacter vanlandii that appear to have the same conserved region found in Pseudomonas putida The species share similar REP elements with the same conserved central palindromic region “GCGGG****CCCGC”

40. Output

41. Significance REP sequences mainly found abundantly in Enterobacteriacaea Study by Bao Ton-Hoang 2012 suggested that transposases could’ve been responsible for the proliferation of REP sequences in the genomes of bacteria in Enterobacteriacaea Possibly suggest a similar origin of REP sequences/elements for Pseudomonas and Enterobacteriacaea?

42. Problems? Found 2 hits in E. Coli K-12 that had the REP element  Maybe suggests similar origin? Could be just a fluke/just by chance that these two organisms share the same REP element in abundance  Past Study found 804 REP sequences with that REP element in Pseudomonas putida  I found 52 in Azotobacter vanlandii

43. Possible plans of the future/near future? Compare with other bacteria in the order of Pseudomondas to see if I get similar results Possibly try to find a link to how REP sequences started proliferating in bacteria outside of Enterobacteriacae

44. Positional Preference of Rho-Independent Transcriptional Terminators in E. Coli Ann Vo

45. Transcriptional Terminators Rho-independent Specific activities poorly understood Occurs in ssDNA and RNA Unique characteristics:  T-Tract: 12-15 nt  GC-rich stem: 4-18 nt

46. Transcriptional Terminators Available algorithms:  RNAMotif  TransTermHP  ARNold About 317 natural terminators found in E. Coli Lai et al. (2013) found a positional preference between other regulatory sequences Do transcriptional terminators have a positional preference relative to the end of the gene?

47. ARNold Erpin  Scores input sequences  Compares against 1,200 known terminators from Bacillus subtilitis and Escherichia coli RNAMotif  Used descriptors to find possible terminators  Scores free energy of hairpin formation

48. Matching Sequences BioBIKE/PhAnToMe  Extracted the 50 nucleotides following every gene Python  Compared sequences to terminators  Calculated distance to terminator ARNold3248 possible terminators BioBIKE5341 downstream sequences Python126 terminators CAGGACGGTTTACCGGGGAGCCATAAACGGCTCCCTTTTCATTGTTATCA ACGGTTTACCGGGGAGCCATAAACGGCTCCCTTTTCATTGTTA downstream sequence terminator

52. Conclusion Appear to exhibit some degree of positional preference Reasons remain unclear Further studies:  Length of terminator  Function of operons

53. References Chen, Ying-Ja et al. “Characterization of 582 Natural and Synthetic Terminators and Quantification of Their Design Constraints.” Nature methods 10.7 (2013): 659–64. Web. 20 Mar. 2014. Ermolaeva, M D et al. “Prediction of Transcription Terminators in Bacterial Genomes.” Journal of molecular biology 301.1 (2000): 27–33. Web. 4 Apr. 2014. Kingsford, Carleton L, Kunmi Ayanbule, and Steven L Salzberg. “Rapid, Accurate, Computational Discovery of Rho-Independent Transcription Terminators Illuminates Their Relationship to DNA Uptake.” Genome biology 8.2 (2007): R22. Web. 17 Apr. 2014. Lai, Fu-Jou et al. “Identifying Functional Transcription Factor Binding Sites in Yeast by Considering Their Positional Preference in the Promoters.” PloS one 8.12 (2013): e83791. Web. 10 Apr. 2014. Lau, Lester F et al. “A Potential Stem-Oop Structure and the Sequence CAAUCAA in the Transcript Are Insufficient to Signal Q-Dependent Transcription Termination at XtR1.” 12.2 (1984): 1287–1299. Print. Macke, T J et al. “RNAMotif, an RNA Secondary Structure Definition and Search Algorithm.” Nucleic Acids Research 29.22 (2001): 4724–35. Mooney, Rachel Anne, and Robert Landick. “Building a Better Stop Sign: Understanding the Signals That Terminate Transcription.” Nature Methods 10.7 (2013): 618–619. Web. 21 Mar. 2014. Naville, Magali et al. “ARNold: A Web Tool for the Prediction of Rho-Independent Transcription Terminators.” RNA Biology 8.1 (2011): 11–13. Web. 8 Apr. 2014.

54. Resemblances and differences between promoter sequences in E. coli and S. enterica Liam Lewis

55. Inspiration Novel sequence-based method for identifying transcription factor binding sites in prokaryotic genomes Results found promoters with high probability

56. Background of Promoter sequences Regulatory Elements -35 and -10 consensus sequence Sigma factor + RNA Polymerase

57. Program used to identify promoters PePPER Uses PSSMs and Hidden markov Models Algorithm is universal for prokaryotes

58. Biobike implementation Biobike to compare both outputs from PePPER.

59. What’s next? Comparison of results Biobike algorithm to accurately predict promoters

60. Comparison of Repressor-Operator Sequences in Lambda and other Temperate Phages Shahroze Abbas

61. Repressor Sequences in Lambda Two possible life cycles, dependent upon either Lambda repressor or Cro repressor. cI repressor maintains lysogenic state Cro repressor initiates a switch to the lytic state Significance of intergenic sequences and neighboring genes to determine ‘hypothetical proteins’ in other organisms similar

62. Comparison of Repressor Sequence Lambda repressor sequence tested for occurrence in other phages Enterobacteria phage Sfl Enterobacteria phage HK244 Enterobacteria phage HK542 Enterobacteria phage HK544 Enterobacteria phage HK 106 Enterobacteria phage CL707

63. Still to come… Analysis of operator sequences Comparison of cro repressor in other phages Trend or pattern to determine function of neighboring proteins in other phages Trend or pattern in sequences between phages