Presentation is loading. Please wait.

Presentation is loading. Please wait.

AP Biology 2007-2008 A Lot More Advanced Biotechnology Tools Sequencing.

Similar presentations


Presentation on theme: "AP Biology 2007-2008 A Lot More Advanced Biotechnology Tools Sequencing."— Presentation transcript:

1

2 AP Biology 2007-2008 A Lot More Advanced Biotechnology Tools Sequencing

3 AP Biology  Sanger method  determine the base sequence of DNA  based on replication  dideoxynucleotides  ddATP, ddGTP, ddTTP, ddCTP  missing O for bonding of next nucleotide  terminates the growing chain DNA Sequencing

4 AP Biology DNA Sequencing  Sanger method  synthesize complementary DNA strand in vitro  in each tube:  “normal” N-bases  dideoxy N-bases  ddA, ddC, ddG, ddT  DNA polymerase  primer  buffers & salt 2 1 3 4 2

5 AP Biology Reading the sequence  Load gel with sequences from ddA, ddT, ddC, ddG in separate lanes  read lanes manually & carefully  polyacrylamide gel

6 AP Biology Fred Sanger 1978 | 1980 This was his 2nd Nobel Prize!!  1st was in 1958 for the structure of insulin

7 AP Biology Advancements to sequencing  Fluorescent tagging  no more radioactivity  all 4 bases in 1 lane  each base a different color  Automated reading

8 AP Biology Advancements to sequencing  Fluorescent tagging sequence data  Computer read & analyzed

9 AP Biology Applied Biosystems, Inc (ABI) built an industry on these machines Advancements to sequencing  Capillary tube electrophoresis  no more pouring gels  higher capacity & faster 384 lanes

10 AP Biology PUBLIC  Joint Genome Institute (DOE)  MIT  Washington University of St. Louis  Baylor College of Medicine  Sanger Center (UK) PRIVATE  Celera Genomics  Big labs!  economy of scale

11 AP Biology Automated Sequencing machines  Really BIG labs!

12 AP Biology Human Genome Project  U.S government project  begun in 1990  estimated to be a 15 year project  DOE & NIH  initiated by Jim Watson  led by Francis Collins  goal was to sequence entire human genome  3 billion base pairs  Celera Genomics  Craig Venter challenged gov’t  would do it faster, cheaper  private company

13 AP Biology Different approaches 3. Assemble DNA sequence using overlapping sequences. “map-based method” gov’t method “shotgun method” Craig Venter’s method 1. Cut DNA entire chromosome into small fragments and clone. 2. Sequence each segment & arrange based on overlapping nucleotide sequences. 1.Cut DNA segment into fragments, arrange based on overlapping nucleotide sequences, and clone fragments. 2. Cut and clone into smaller fragments.

14 AP Biology Human Genome Project On June 26, 2001, HGP published the “working draft” of the DNA sequence of the human genome. Historic Event!  blueprint of a human  the potential to change science & medicine

15 AP Biology Sequence of 46 Human Chromosomes 3 billion base pairs 3G of data

16 AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA CATCGACCTGCTCGTACATGCTACTAGCTACTG ACTCATGATCCAGATCACTGAAACCCTAGATC GGGTACCTATTACAGTACGATCATCCGATCAGA TCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGAT ACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATC CGATCAGATCATGCTAGTACATCGATCGATACT GCTACTGATCTAGCTCAATCAAACTCTTTTTGC ATCATGATACTAGACTAGCTGACTGATCATGAC TCTGATCCCGTAGATCGGGTACCTATTACAGTA CGATCATCCGATCAGATCATGCTAGTACATCGA TCGATACT human genome 3.2 billion bases

17 AP Biology Raw genome data

18 AP Biology NCBI GenBank Database of genetic sequences gathered from research Publicly available on Web!

19 AP Biology Organizing the data

20 AP Biology Maps of human genes…  Where the genes are…  mapping genes & their mutant alleles

21 AP Biology Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene polypeptide 1 polypeptide 2 polypeptide 3 protein gene It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. RNA gene

22 AP Biology And we didn’t stop there…

23 AP Biology The Progress First 2 bacterial genomes complete 122+ bacterial genomes Data from NCBI and TIGR (www.ncbi.nlm.nih.gov and www.tigr.org )www.ncbi.nlm.nih.govwww.tigr.org first eukaryote complete (yeast) first metazoan complete (flatworm) 17 eukaryotic genomes complete or near completion including Homo sapiens, mouse and fruit fly Official “15 year” Human Genome Project: 1990-2003. # of DNA base pairs (billions) in GenBank

24 AP Biology How does the human genome stack up? Organism Genome Size (bases) Estimated Genes Human (Homo sapiens) 3 billion30,000 Laboratory mouse (M. musculus) 2.6 billion30,000 Mustard weed (A. thaliana) 100 million25,000 Roundworm (C. elegans) 97 million19,000 Fruit fly (D. melanogaster) 137 million13,000 Yeast (S. cerevisiae) 12.1 million6,000 Bacterium (E. coli) 4.6 million3,200 Human Immunodeficiency Virus (HIV) 97009

25 AP Biology What have we found?  When you go looking…

26 AP Biology …you will certainly find something!


Download ppt "AP Biology 2007-2008 A Lot More Advanced Biotechnology Tools Sequencing."

Similar presentations


Ads by Google