1. DNA sequencing: Importance Basic blueprint for life; Aesthetics. Gene and protein. –Function –Structure –Evolution Genome-based diseases- “inborn errors of metabolism.” – Genetic disorders – Genetic predispositions to infection –Diagnostics –Therapies

2. DNA sequencing methodologies Maxam-Gilbert –base modification by general and specific chemicals. –depurination or depyrimidination. –single-strand excision. –not amenable to automation Sanger –DNA replication. –substitution of substrate with chain- terminator chemical. –more efficient –automation??

3. Maxam-Gilbert chemical method

4. versus “bio” based methods Sanger dideoxynucleotides

5. DNA biochemistry

6. Sequence Masters Fred Sanger, 1958 –Was originally a protein chemist –Made his first mark in sequencing proteins –Made his second mark in sequencing RNA 1980 dideoxy sequencing

7. The Sanger Method Random incorporation of a dideoxynucleoside triphosphate into a growing strand of DNA Requires DNA polymerase I.. Why? Requires a cloning vector with initial primer (M13, high yield bacteriophage, modified by adding: beta-galactosidase screening, polylinker) Uses 32 P-deoxynucleoside triphosphates

9. Sanger Method Sequencing Gel

10. DNA sequencing: biochemistry O C N purine or pyrimidine P O O OH P O O P O O HO P O O OH OO C N purine or pyrimidine OH 5’ 3’

11. DNA sequencing: Sanger dideoxy method I O C N purine or pyrimidine P O O OH P O O P O O HO H dideoxyribonucleoside triphosphate (ddNTP)

12. DNA sequencing: Sanger II O C N purine or pyrimidine P O O OH P O O P O O HO P O O OH OO C N purine or pyrimidine H chain termination method

13. DNA sequencing: Chemistry

14. template + primers + polymerase +label at? 1 dCTP dTTP dGTP dATP ddATP* 2 dCTP dTTP dGTP dATP ddGTP* 3 dCTP dTTP dGTP dATP ddTTP* 4 dCTP dTTP dGTP dATP ddCTP* extension electrophoresis AT GC AT TA CG TA GC AT GC TA CG TA GC AT

15. Manual radioactive sequencing

16. DNA sequencing: Chemistry template + polymerase + 1 dCTP dTTP dGTP dATP ddATP primer 2 dCTP dTTP dGTP dATP ddGTP primer 3 dCTP dTTP dGTP dATP ddTTP primer 4 dCTP dTTP dGTP dATP ddCTP primer extension electrophoresis AT GC AT TA CG TA GC AT GC TA CG TA GC AT

17. Semi-automated fluorescent DNA sequencing Fred Sanger et. al., 1977. Walter Gilbert et. al., 1977. Leroy Hood et. al. 1986. Applied Biosystems, Inc. DuPont Company.

18. DNA sequencing: upgrade, second iteration, terminator-label Disadvantages of primer-labels: –four reactions –tedious –limited to certain regions, custom oligos or –limited to cloned inserts behind ‘universal’ priming sites. Advantages: Solution: –fluorescent dye terminators

19. DNA sequencing: Chemistry template + polymerase + dCTP dTTP dGTP dATP ddATP ddGTP ddTTP ddCTP extension electrophoresis ATGCATTACGTAGCGCATGCTATACGTAGCATATGCATTACGTAGCGCATGCTATACGTAGCAT

20. DNA sequencing: Chemistry

21. Sequence Masters Walter Gilbert –Harvard physicist –Knew James Watson –Became intrigued with the biological side –Became a biophysicist Allan Maxam

22. The Maxam-Gilbert Technique Principle - Chemical Degradation of Purines –Purines (A, G) damaged by dimethylsulfate –Methylation of base –Heat releases base –Alkali cleaves G –Dilute acid cleave A>G

23. The Maxam-Gilbert Technique Principle – Chemical Degradation of Pyrimidines –Pyrimidines (C, T) are damaged by hydrazine –Piperidine cleaves the backbone –2 M NaCl inhibits the reaction with T

24. The Maxam- Gilbert Method

25. Comparison Sanger Method –Enzymatic –Requires DNA synthesis –Termination of chain elongation Maxam Gilbert Method –Chemical –Requires DNA –Requires long stretches of DNA –Breaks DNA at different nucleotides

26. Sequencing Gives: The letters in a sentence Remember Prions? –Short sequence in genomes –Single nucleotide change in alleles Valine - Valine = not susceptible to BSE Methionine - Valine = at risk Methionine-methionine = watch out! How can we genetically screen for single nucleotide differences?

27. Applications DNA sequencing Whole genome analysis Comparative genomics Applications to subfields