2. Hoover High School Mr.Plazaks Biology

3. : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA strand: GCCACGT

4. CGGUGCA

5. A certain protein is 60 amino acids long. How many nucleotides are required in DNA to code for this protein?

6. 180

7. What type of molecule is codon is found in?

8. mRNA

9. A:B: Write an answer here C:D: Define Translation

10. The process by wich an mRNA molecule is translated into a protien

11. A: The genes in the chromosomes of living cells are made of what?

12. DNA

13. A:B: Write an answer here The process of reading mRNA and turning it into a polypeptide chain is known as what?

14. Translation

15. Give the complimentary DNA sequence of the following DNA: ATCGGTGAACGTAACCATTTAAA

16. TAGCCACTTGCATTGGTAAATTT

17. The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?

18. GUA

19. A:B: Write an answer here Define Mutation?

20. Changes in the DNA sequence that affect genetic information

21. Inheritance of acquired characteristics

22. Great Job!!!! Great Job!!!! Thank you for playing! Thank you for playing!