1. Biology Unit Review Game

2. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A – Plant cells – cell wall, larger vacuoles, chloroplasts. Animal cells – flagellum/cilia, smaller vacuoles What is the purpose of the ribosome? What is the purpose of the ribosome? A – Produces proteins What is the power house of the cell? What is the power house of the cell? A – Mitochondria

3. Cell Parts Continued What is the purpose of the endoplasmic reticulum? What is the purpose of the endoplasmic reticulum? A – To transport materials within the cell. How do proteins leave the cell? How do proteins leave the cell? A – They are packaged in vesicles (at the end of the Golgi body) and are carried to the cell membrane. What would happen if the nucleus of a cell was taken out? What would happen if the nucleus of a cell was taken out? A – The cell would die.

4. DNA Where is DNA found? Where is DNA found? A – The nucleus What does DNA stand for? What does DNA stand for? A – deoxyribonucleic acid What shape does DNA take? What shape does DNA take? A – Double helix What three parts make up DNA? What three parts make up DNA? A – Sugar, phosphate, and bases

5. DNA What does A, G, C and T stand for? What does A, G, C and T stand for? A – adenine, guanine, cytosine, and thymine What does adenine pair with? What does adenine pair with? A – thymine Most of the time, DNA exists in the nucleus in the form of what? Most of the time, DNA exists in the nucleus in the form of what? A – chromatin What does DNA code for? What does DNA code for? A – proteins

6. Chromosomes How many pairs of chromosomes are found in human cells? How many pairs of chromosomes are found in human cells? A – 23 pairs If your 23 rd pair of chromosomes is XY, you would be a … If your 23 rd pair of chromosomes is XY, you would be a … A – male/boy Small segments of DNA are called what? Small segments of DNA are called what? A - genes

7. Genes/Proteins What is the importance of genes? What is the importance of genes? A – stores information needed to produce specific proteins. Which of the following are not specialized proteins: hormones, nucleolus, enzyme? Which of the following are not specialized proteins: hormones, nucleolus, enzyme? A – nucleolus Why are stomach cells different from skin cells? Why are stomach cells different from skin cells? A – different proteins have been made for each cell.

8. Protein Production What does RNA stand for? What does RNA stand for? A – ribonucleic acid How is the message for a protein to be made carried from the nucleus to the ribosomes? How is the message for a protein to be made carried from the nucleus to the ribosomes? A – DNA message for a specific protein is copied into RNA which leaves through the nuclear pore and delivers the message to the ribosome. What is the function of the Golgi body? What is the function of the Golgi body? A – To repackages the protein for transport out of the cell.

9. Mutations What type of mutation is occurring in the following DNA sequence (and where): What type of mutation is occurring in the following DNA sequence (and where):CATGCCTGACGTCTGATGCCA Mutation 1: CATGCCTGACCTCTGATGCCA A – Substitution – CATGCCTGACCTCTGATGCCA Mutation 2: CATGCCTGACGTCTGATGCCAA A – Addition – CATGCCTGACGTCTGATGCCAA Mutation 3: CATCCTGACGTCTGATGCCA A – Deletion - CATCCTGACGTCTGATGCCA

10. Chapter 5 – Mitosis What is the longest stage of the cell cycle? What is the longest stage of the cell cycle? A – interphase What occurs during interphase? What occurs during interphase? A – growth and preparation, DNA replication, protein synthesis. What are the other two stages of the cell cycle? What are the other two stages of the cell cycle? A – mitosis and cell division (cytokinesis) Why does a cell divide? Why does a cell divide? A – The surface area to volume ratio is small.

11. DNA Replication What is the first step in DNA replication? What is the first step in DNA replication? A – DNA sides separate What aids in separating the DNA sides? What aids in separating the DNA sides? A – enzymes What occurs in step 2 of DNA replication? What occurs in step 2 of DNA replication? A – New bases pair with the bases on the original DNA Why is DNA replication important? Why is DNA replication important? A – So that when the cell divides, the new daughter cells will have all of the genetic information.

12. In the diagram to the right, what do the two sister chromatids have in common? In the diagram to the right, what do the two sister chromatids have in common? A – They are replicated chromosomes. They are identical copies of the DNA.

13. What phase of mitosis is occurring in the diagram to the right? What phase of mitosis is occurring in the diagram to the right? A – anaphase What phase occurs before anaphase? What phase occurs before anaphase? A – metaphase What occurs during metaphase? What occurs during metaphase? A – The chromosomes line up across the middle (equator) of the cell

14. What is being produced during telophase of mitosis? What is being produced during telophase of mitosis? A – two nuclei What are two difference between mitosis/cytokinesis in plants and animals? What are two difference between mitosis/cytokinesis in plants and animals? A – Plants doen’t have centrioles and animals don’t produce a cell plate. If you started out with 365 chromosomes in the parent cell, how many chromosomes would each of the daughter cells have? If you started out with 365 chromosomes in the parent cell, how many chromosomes would each of the daughter cells have? A – 365

15. What is the correct order of the stages of mitosis? What is the correct order of the stages of mitosis? A – prophase, metaphase, anaphase, telophase What is another word for cell division? What is another word for cell division? A – cytokinesis How many parents are there in asexual reproduction? How many parents are there in asexual reproduction? A - One

16. Asexual Reproduction Which of the following is not a type of asexual reproduction: spore formation, gamete formation, binary fission, budding, fragmentation, vegetative reproduction? Which of the following is not a type of asexual reproduction: spore formation, gamete formation, binary fission, budding, fragmentation, vegetative reproduction? A – gamete formation Define clone. Define clone. A - A - a genetically identical offspring of an single parent.

17. Asexual Reproduction What type of asexual reproduction is occurring in the picture to the right? What type of asexual reproduction is occurring in the picture to the right? A: budding Give an example of an organism that reproduces this way. Give an example of an organism that reproduces this way. A: hydra, sponge, yeast

18. Asexual Reproduction What type of asexual reproduction is occurring in the picture to the right? What type of asexual reproduction is occurring in the picture to the right? A: binary fission How many cells are dividing? How many cells are dividing? A: One What is the benefit of this type of reproduction? What is the benefit of this type of reproduction? A: Genetically identical offspring.

19. Asexual Reproduction How do Eurasian milfoil and starfish reproduce? How do Eurasian milfoil and starfish reproduce? A – fragmentation A graft would be made during what type of asexual reproduction? A graft would be made during what type of asexual reproduction? A – vegetative reproduction. Give an example that uses spore formation as it reproductive method. Give an example that uses spore formation as it reproductive method. A – bread mould, mosses, ferns, fungi

20. Chapter 6 - Meiosis An egg and sperm are produced where? An egg and sperm are produced where? A: in the ovaries and testes What is a haploid cell considered? What is a haploid cell considered? A: a gamete How many chromosomes will an egg or sperm cell have if the parent cell had 46 chromosomes? How many chromosomes will an egg or sperm cell have if the parent cell had 46 chromosomes? A – 23 chromosomes.

21. Meiosis I What stage of meiosis is occurring in the picture to the right? What stage of meiosis is occurring in the picture to the right? A: metaphase I What has lined up along the equator? What has lined up along the equator? A: homologous chromosomes. What occurs during anaphase I? What occurs during anaphase I? A: Homologous chromosome pairs are pulled away from each other towards opposite ends of the cell. Sister chromatids still attached.

22. Meiosis II What occurs during anaphase II? What occurs during anaphase II? A: The sister chromatids are split apart at the centromere and move to opposite poles. How many chromosomes are in each of the daughter cells at the end of meiosis? How many chromosomes are in each of the daughter cells at the end of meiosis? A: Half the number as the parent cell. Why does meiosis occur? Why does meiosis occur? A: So that sperms and eggs only have half the number of chromosomes so when meet, full set.

23. When a egg and sperm cell meet, what is this process called? When a egg and sperm cell meet, what is this process called? A: fertilization What is the cell called when fertilization occurs? What is the cell called when fertilization occurs? A: a zygote A zygote is considered what type of cell; haploid or diploid? A zygote is considered what type of cell; haploid or diploid? A: diploid

24. When looking at a karyotype of a person that has the Edwards syndrome, what will be different on the karyotype from someone who does not have the Edwards syndrome? When looking at a karyotype of a person that has the Edwards syndrome, what will be different on the karyotype from someone who does not have the Edwards syndrome? A: There is an extra chromosome at site 12. What other syndrome would have an extra chromosome in each cell? What other syndrome would have an extra chromosome in each cell? A: Down syndrome

25. What are two advantages of asexual reproduction? What are two advantages of asexual reproduction? A: genetically identical offspring, lots of offspring can be reproduced quickly. What is the major advantage of sexual reproduction? What is the major advantage of sexual reproduction? A: Genetic diversity

26. Embryonic Development List the following stages of human development in order: blastula, zygote, fetus, gastrula, morula List the following stages of human development in order: blastula, zygote, fetus, gastrula, morula A: zygote, morula, blastula, gastrula, fetus Which of the stages above would consist of a ball of cells? Which of the stages above would consist of a ball of cells? A: morula Which of the stages above would consist of a hollow ball of cells? Which of the stages above would consist of a hollow ball of cells? A: bastula

27. What to Study Multiple Choice Chapter 4 Know the organelles and their functions Know the organelles and their functions Know what makes up DNA and its purpose Know what makes up DNA and its purpose What do each of the bases pair up with What do each of the bases pair up with Know the general idea of how proteins are made Know the general idea of how proteins are made Know what a mutation is and the different types – deletion, addition, substitution Know what a mutation is and the different types – deletion, addition, substitution

28. What to Study continued… Chapter 5 Stages of the cell cycle – interphase, mitosis, cytokinesis Stages of the cell cycle – interphase, mitosis, cytokinesis DNA replication DNA replication Mitosis stages – what occurs at each stage Mitosis stages – what occurs at each stage What is the purpose of mitosis What is the purpose of mitosis What is the end result of mitosis What is the end result of mitosis Different types of asexual reproduction Different types of asexual reproduction

29. What to Study continued… Chapter 6 What is the purpose of meisosis What is the purpose of meisosis Where does meiosis occur, what is produced, what is the end result of meiosis Where does meiosis occur, what is produced, what is the end result of meiosis Know stage I and II of meisosis Know stage I and II of meisosis What occurs when egg and sperm cells join What occurs when egg and sperm cells join Karyotypes – what can we detect Karyotypes – what can we detect Embryonic development Embryonic development Don’t worry about assisted reproductive technologies or internal/external fertilization Don’t worry about assisted reproductive technologies or internal/external fertilization