1. 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview and Context of the Technology of Synthethic Biology

2. 2 Mice from dirty rags & wheat bran Life has not now been created from inanimate matter.

3. 33 Synthetic genomes are a BTD (Big Technical Deal) Natural living systems, Direct generational descent, Replication with error, Natural selection. Synthetic living systems, “Decoupled” promulgation over time, Replication with representation, Fashioned selections.

4. 44 Big stresses can arise when material and information become interconvertible. - Changes in business and distribution models (ongoing transitions from CDs & DVDs, to MP3s & Internet TV) - Challenges to safety & security frameworks (from control of material, to control of information) - Avoidance of nation state and cultural relations (border controls for DNA sequences on the internet, really?) - Increases in scale and pace (overloading of current practices)

5. 5 TAATACGACTCACTATAGGGAGA DNA Construction = #1 Tech. of 21st Ctry. From absract information to physical, living DNA designs. 2004: 10,000 bp 2010: 1,000,000 bp 2016: 100 million?

6. 6 ~99% Genetic Engineering: <20 kb DNA, ~1 dozen DNA components Genome Synthesis: >8 mb DNA, ~1000+ DNA components?! ~4 meter gap 400-fold “biointegration gap,” today. (We are relatively bad at putting the molecules of biology back together in useful ways)

7. 7 if {growing} call wintergreen() else call bananas() Beyond synthetic genomes: We’ll need languages & grammars for writing DNA poetry

8. 8 To Have the Chance of Being Ethical, We Must Lead Future Biotech. Tool Revolutions DNA Sequencing Read Out the Genetic Code Recombinant DNA Basic “Cut” & “Paste” Polymerase Chain Reaction Amplify & Make Simple Changes First Gen. Biotech =... Next Gen. Biotech Adds New Tools =

9. 9 - We often learn best by tinkering. Today, most of biology remains unknown; we stand to learn more than ever before via a synthetic approach. The Technical Ethics of Synthetic Biology - Freedom of the (DNA) press. There are now no sustained public investments in getting better at building DNA; leverage over the presses can lead to control of content (i.e., what is written). - Preparedness and reconciliation. More accidents will happen; more misuses will occur; nature is not a liberal representative democracy; how do we make such truths not intolerable? - Institutions & individuals; hackers are community. The tools of synthetic biology make biotechnology, today’s *most* compelling technology, available to many. Do we enable or ostracize a future world of “Do-It-Together” biotechnology? Let’s not overlook many basics (e.g., property rights).