1. Research Proposal Libo Cao Ph.D., Analytical (Dr. Peter de B. Harrington) Ohio University Department of Chemistry and Biochemistry Athens, OH 45701-2979 Ohio University Center for Intelligent Chemical Instrumentation

2. I. Introduction Molecular Beacon (MB) Single-stranded oligonucleotide probes with a hairpin structure that can identify the mutations in the human genome caused by DNA hybridization. Principle of Operation of MBs

3. Ohio University Center for Intelligent Chemical Instrumentation Advantages Over Other DNA Probes Extremely high selectivity with single base pair mismatch identification capability The excellent capability of studying biological process in real time and in vivo, and avoiding the inconvenience caused by using DNA intercalation reagents or by labeling the target molecules or using competitive assays

4. Ohio University Center for Intelligent Chemical Instrumentation What MBs can do? Detection of single-nucleotide variations Single-base mismatch DNA sequencing DNA biosensor based on MBs Sensitive monitoring of the polymerase chain reaction Real-time detection of DNA-RNA hybridization in living cells

5. Ohio University Center for Intelligent Chemical Instrumentation Structure of A, T, C, G

6. Ohio University Center for Intelligent Chemical Instrumentation Label Dyes with the Biomolecular Davidson, R. S.; Hilchenbach, M. M. Photochem. Photobiol. 1990, 52, 431. Carboxylic group Sulfonyl group N-Hydroxysuccinimide 1,3-dicycolhexylcarbodiimide Dimethyl formamide

7. Ohio University Center for Intelligent Chemical Instrumentation How Dye Ester Linked with Sequencing Primer

8. Ohio University Center for Intelligent Chemical Instrumentation The Structure of a Molecular Beacon Dye1-5’-GCGAGAAGTTAAGAACCTATGCTCGC-3’-Dye2 Can be written as: Dye1 Dye2

9. Ohio University Center for Intelligent Chemical Instrumentation Efficiency Evaluation of the MBs One fluorophoreTwo fluorophores Mechanism Efficiency Parameter

10. Ohio University Center for Intelligent Chemical Instrumentation Fluorescence Resonance Energy Transfer (FRET) Hillisch, A.; Lorenz, M.; Diekmann, S. Curr. Opin. Struc. Biol. 2001, 11, 201. FRET involves non-radiative transfer of electronic excitation from an excited donor, D * to a ground state acceptor molecule A, and occur at distances ranging from 10 to approximately 100 Å.. E – Energy transfered – Förster critical distance R – Distance between the donor and acceptor

11. Ohio University Center for Intelligent Chemical Instrumentation Effect of Auto fluorescence http://www.diatronscience.com/AutoFluor.htmlhttp://www.diatronscience.com/AutoFluor.html. Auto fluorescence of Gray Snapper (L.griseus) Oocyte

12. Ohio University Center for Intelligent Chemical Instrumentation My Goals of Designed Molecular Beacons Longer wavelength to avoid background noise Two Fluorophores The two dyes chosen should be able to FRET

13. Ohio University Center for Intelligent Chemical Instrumentation Choose Donor and Acceptor Dyes

14. Ohio University Center for Intelligent Chemical Instrumentation FRET Between Cy3 and Cy5 Attached to a Coiled-coil of Homodimer Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. α-tropomyosin (αTm) Schematic drawing of a protein, Tyopomyosin, A coiled-coil in the native state is denatured into two polypeptide chains by denatureant, temperature and lowering salt concentration at room temperature. Thick lines represent α-helix and thin lines random coil polypeptide. Donor (D) and acceptor (A) fluorephores are labeled to a single cysteine residue at 190 th position

15. Ohio University Center for Intelligent Chemical Instrumentation Fluorescence Spectrum for Tm Labeled with Cy3 and Cy5 in Bulk Measurements Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163.

16. Ohio University Center for Intelligent Chemical Instrumentation Fluorescence images of FRET within a Single Protein Molecule Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. (a)The donor (Cy3) images taken with a band-pass filter of 545-595 nm on excitation at the donor (b)The acceptor (Cy5) images due to FRE T taken with a band-pass filter of 650-710 nm on excitation at the donor

17. Ohio University Center for Intelligent Chemical Instrumentation Fluorescence Intensity of the Donor Fluorescence Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163.

18. Ohio University Center for Intelligent Chemical Instrumentation Fluorescence Intensity of the Increase in the Acceptor Fluorescence Due to FRET Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163.

19. Ohio University Center for Intelligent Chemical Instrumentation Fluorescence Spectrum from a single Cy3-Cy5-Labeled αTm molecule Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163.

20. Ohio University Center for Intelligent Chemical Instrumentation Time Records of the Donor and Acceptor Fluorescence from a Single Cy3-Cy5 Labeled αTm molecule Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163.

21. Ohio University Center for Intelligent Chemical Instrumentation Designed MB and target DNA sequences _______________________________________________________________________ MB: 5’-Dye1-GCTCGTCCATGCCCAGGAAGGAGGCAACGACACGAGC-Dye2-3’ Target: 5’-GTCGTTGCCTCCTTCCTGGGCATGG-3’ ________________________________________________________________________ Dye1=Cy3 Dye2=Cy5 Dye2 Dye1

22. Ohio University Center for Intelligent Chemical Instrumentation Model of the D/A DNA Constructs with Varying Distance Dietrich, A.; Buschmann, V.; Mller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211.

23. Ohio University Center for Intelligent Chemical Instrumentation Schematic Diagram of the Optical Setup Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211 1) Frequency-doubled Nd:YAG (Neodymium) laser emitting at 532 nm 2) The collimated laser beam was directed into an inverted microscope and coupled into the microscope objective with high numerical apertures via a dichroic beam splitter 3) Within the microscope objective, the beam was focused into the sample to detect freely diffusing FRET constructs 4) The fluorescence light was collected through the same objective and imaged onto the active areas of two avalanche photodiodes 5) Need additional band pass filters in front of the APDs

24. Ohio University Center for Intelligent Chemical Instrumentation Spectroscopic Characteristics of the Different FRET Constructs In Aqueous Buffer Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211. -- Relative fluorescence quantum yield of donor -- FRET energy of donor decreased -- FRET energy of acceptor increased

25. Ohio University Center for Intelligent Chemical Instrumentation Fluorescence Emission Spectra of the Different FRET Constructs in Aqueous Buffer Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211.

26. Ohio University Center for Intelligent Chemical Instrumentation FRET Histograms Extracted from Single Molecule Data of the Differently Labeled D/A Constructs and Corresponding Gaussian Fits Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211.

27. Ohio University Center for Intelligent Chemical Instrumentation A Fiber-Optic Evanescent Wave DNA Biosensor Based on This MB Advantages: 1) The DNA sensor based on a MB does not need labeled analyte or intercalation reagents. 2) Can be used to directly detect, in real time target DNA/RNA molecules without using competitive assays. 3) It is rapid, stable, highly selective, and reproducible.

28. Ohio University Center for Intelligent Chemical Instrumentation Scheme of immobilization of biotinlyed MB DNA on optical fiber surface Liu, X; Tan, W. Anal. Chem. 1999, 71, 5054.

29. Ohio University Center for Intelligent Chemical Instrumentation Dynamics of Hybridization of MB Evanescent Wave Sensor (a)Noncomplementary oligonucleotide (b)One-base-mismatched oligonucleotide (c)Complementary oligonucleotide All in aqueous buffer containing 1 M NaCl

30. Ohio University Center for Intelligent Chemical Instrumentation Experiment--Donors and Acceptors for the MBs

31. Ohio University Center for Intelligent Chemical Instrumentation Four MBs Designed 5’-Cy3-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’ 5’-TMR-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’ 5’-R6G-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’ 5’-TMR-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-JA133-3’

32. Ohio University Center for Intelligent Chemical Instrumentation DNA Sequences Needed Complementary DNA: CGAGCGGTACGGGTCCTTCCTCCGTTGCTGGCTCG One-base-mismatch DNA: CGAGCGGTACGGGTCCTACCTCCGTTGCTGGCTCG Two-base-mismatch DNA: CGAGCGGTACGGGTCCTAGCTCCGTTGCTGGCTCG Non-complementary DNA: CGAAACCTGCGAATGGTAGCTCCAATGTGGAATCG

33. Ohio University Center for Intelligent Chemical Instrumentation Estimation of the FRET parameters -- quantum yield of the donor -- orientation factor k² -- overlap integral J -- refraction index of the medium n R 0 of the four investigated D/A pairs are: 63.5for (R6G/Cy5) for (TMR/Cy5) for (Cy3/Cy5) for (TMR/JA133) 64.5 55.8 59.0

34. Ohio University Center for Intelligent Chemical Instrumentation Schematic of Experimental Setup Laser source Sample Microscope objective Beam splitter APD Band-pass filters Counting board Personal computer

35. Ohio University Center for Intelligent Chemical Instrumentation Evaluation of efficiency for MBs

36. Ohio University Center for Intelligent Chemical Instrumentation Cost Analysis DNA sequences <$300 Molecular beacons <$5000 Optical Setup <$5000 Computer with software <$6000 Other Chemicals <$2000

37. Ohio University Center for Intelligent Chemical Instrumentation Novelty of my work FRET have been used to measure distances in protein structures and their assemblies in solution, have not been used in MB application yet. My proposal integrated FRET technique into MB. Idea of two fluorophore MB were created in 2001, no such MB are created yet. My proposal created several MB that will have higher efficiency than current MBs.

38. Ohio University Center for Intelligent Chemical Instrumentation CONCLUSIONS A new strategy of designing MBs which uses two fluorophores (Cy3 and Cy5) instead of one fluorophore and one quencher as the donor and acceptor was proposed MBs display high sensitivity and a large dynamic range Such MBs are able to detect target DNA with 35 bases up to 1x10-7 M

39. Ohio University Center for Intelligent Chemical Instrumentation Future Work Studying protein-DNA/RNA interactions Fluorescent immunoassay DNA sequencing` Other bio-molecular analyses

40. Ohio University Center for Intelligent Chemical Instrumentation Acknowledgements Dr. Pete B Harrington Mariela Ochoa Preshious Rearden Bryon Moore