1. Microbial Genetics: DNA Replication Gene Expression
Lecture 6
Microbial Genetics:
DNA Replication
Gene Expression

2. Genetics Genome= Cells genome organized into chromosomes Chromosome=
Gene= segment of the DNA that codes for one protein

3. Bacterial Chromosome Single circular chromosome composed of DNA
Looped and folded and attached at one or more points to the plasma membrane
Supercoiled

4. Bacterial Plasmids Many prokaryotic cells also contain plasmids
They replicate independently from the chromosome

5. Nucleic Acids 2 types of nucleic acids: Subunit: Nucleotides
Deoxyribonucleic acid (DNA)
Ribonucleic acid (RNA)
Subunit: Nucleotides 5

6. Nucleotide 6

7. Nitrogen containing bases
5 Different:
Purines: Adenine (A)
Guanine (G)
Pyrimadines: Thyamine (T)
Cystosine (C)
Uracil (U) 7

8. Synthesis of DNA
Dehydration synthesis- forming of covalent bonds between nucleotides
Forms between phosphate group of one nucleotide and sugar of another nucleotide
Phosphate joins #3 carbon of one sugar with #5 carbon of the other
Results in backbone of alternating sugar and phosphate molecules

9. 9

10. Double Helix of DNA Strand are held together by hydrogen bonds
A pairs with T
G pairs with C
# of A= # of T
# of G=# of C
DNA sequence: read from 5’ to 3’
Sequence example: ATTAGCA etc. 10

11. 11

14. DNA Replication

15. DNA Replication
Purpose is to create new DNA strand, so that upon binary fission, each of the 2 cells receives a complete copy of DNA
Bidirectional- from distinct starting point- proceeds in both directions
Semi- conservative- each of the 2 DNA helix’s generated contains 1 new strand and 1 old strand

16. First Stage: Initiation
DNA unwinds and strands separate
As the DNA unzips, two replication forks form and move in opposite directions away from the origin

17. Second Stage: Elongation
Enzymes synthesize a new stand to pair with each original strand
Nucleotides can only be added in 3’ to 5’ direction
This creates leading and lagging strands
The lagging strand is synthesized in Okazaki fragments, which are joined by DNA ligase

18. Figure 8.4

19. Third Stage: Termination
Two DNA helices separate from each other
Each chromosome now contains one old and one new strand

20. Figure 8.5

21. Figure 8.6b

22. Gene Expression:
Transcription
Translation

23. Central Dogma of Molecular Biology
DNA  RNA  Protein
Gene Expression: The production of a protein product from a gene
Involves two steps: transcription and translation

24. Gene Expression Series of two processes that link genes to proteins
Transcription: synthesis of RNA from DNA
Translation: synthesis of protein from RNA

25. Transcription DNA used as template
Use one strand of DNA to make mRNA molecule
mRNA is complementary to one strand of DNA

26. Initiation of Transcription
Transcription begins when RNA polymerase recognizes and binds to sequence of nucleotides in the DNA called the promoter
The promoter orients the RNA polymerase in one of two possible directions, telling it which DNA strand to use

27. Transcription- Elongation
RNA polymerase moves along template strand of DNA, synthesizing the complementary single-stranded RNA molecule
RNA synthesized in 5’ to 3’ direction, nucleotides added to 3’ end
Very fast: 30 nucleotides per second

28. Transcription- Termination
When RNA polymerase encounters terminator it falls off DNA
Once terminated RNA is called mRNA

29. Figure 8.7 (Overview) (1 of 7)

30. mRNA Messenger RNA Temporary copy of genetic information
3 nucleotides of DNA  3 nucleotides of RNA
3 nucleotides of RNA is a codon
One codon codes for one amino acid
String of amino acids with proper 3-D shape  protein

31. Translation
Process by which information on mRNA is decoded to synthesize the specified protein
Proteins synthesized by adding amino acids sequentially
Remember: one codon  one amino acid
How many amino acids would one protein contain if it was translated from an mRNA that is 690 nucleotides long?

32. AUGCGGCAGACCAAACGAUUGGUUGCGUAA
How many codons?
List the codons:
AUG CGG CAG ACC AAA CGA UUG GUU
GCG UAA

33. The Genetic Code: Universal for all living things

34. Translation Process of translation requires three major components
mRNA
Ribosomes
tRNA

35. Ribosomes Serve as sites of translation, or sites of protein synthesis
Prokaryotic ribosomes are 70S
Large subunit- 50S
Small subunit- 30S

37. tRNA Transfer RNA Carries amino acids to the ribosome
Recognize and base-pair with a specific codon and deliver appropriate amino acid to site
Recognition occurs because each tRNA has an anti-codon, which is complementary to codon on mRNA

39. Initiation of Translation
Translation begins as the mRNA is still being synthesized
30S subunit binds to ribosome-binding site
tRNA and 50S subunit soon join
AUG- start codon- codes for methionine

40. Elongation Ribosome moves along mRNA
As the next codon is exposed, a new tRNA with correct anti-codon moves in
As each tRNA brings in the correct amino acid it forms a covalent bond to it’s neighboring amino acid
Elongation continues until stop codon is reached

42. Regulation of Gene Expression
Protein synthesis requires a huge amount of energy
Regulation of protein synthesis conserves energy for the cell
Repression and Induction
Operon model of gene expression

43. Repression and Induction
Repression: inhibits gene expression and decreases the synthesis of enzymes
Mediated by regulatory proteins called repressors
Induction: process that turns on the transcription of a gene
Mediated by regulatory proteins called inducers

44. Operon model of gene expression
Read over Operon Model of Gene Expression before class (page )
Work in groups to understand the concept