Presentation is loading. Please wait.

Presentation is loading. Please wait.

4/20/12 Bell Ringer I'm called by three letters Though I have a long name. I'm in all of you, But I'm never the same. I'm all coiled up So that I am quite.

Similar presentations


Presentation on theme: "4/20/12 Bell Ringer I'm called by three letters Though I have a long name. I'm in all of you, But I'm never the same. I'm all coiled up So that I am quite."— Presentation transcript:

1 4/20/12 Bell Ringer I'm called by three letters Though I have a long name. I'm in all of you, But I'm never the same. I'm all coiled up So that I am quite small, But if you stretch me out I'll be really tall. I could be the root Of certain disease; If man can unlock me He'll solve many mysteries. WHAT AM I?!?!

2 DNA Pg. 281-284

3 What Is DNA? DeoxyriboNucleic Acid (DNA) o Discovered in 1953 o James Watson and Francis Crick with the help of Rosalind Franklin

4 Located in the nucleus of cells

5 Coiled as chromosomes

6 Your DNA contains sections of heredity traits (genes)

7 DNA Codes For Proteins (enzymes) o Large complex molecules that do most of the work in cells. o Required for the structure, function, and regulation of the body’s tissues and organs. o Enzymes control the chemical reactions needed for life.

8 DNA Structure/ Shape Double Helix Like a twisted zipper Structure on the outside: - Phosphate + sugar (deoxyribose) on the inside - Nitrogenous bases (A, T, G, C) Phosphate + Sugar + Nitrogenous Base= Nucleotide

9 Nitrogen Bases Base Pairs: Adenine (A) ------ Thymine (T) Cytosine (C ) ------ Guanine (G) Attached by weak Hydrogen Bonds

10 The sequence of nucleotides form the unique genetic information of an organism

11 What Does DNA Do Codes for proteins and traits like a recipe for that organism!! HOW? 1.Replication 2.Transcription 3.Translation

12 What is DNA Replication? Replication= Copying - Before Mitosis and Meiosis during Interphase

13 3 Step Process of Replication 1. DNA strand “Unzips”

14 3 Step Process of Replication 2. Base pairing of new nucleotides to original strand

15 3 Step Process of Replication 3. Matching of base pairs until two DNA molecules are formed Each one identical to the original.

16

17 Let’s Predict the complementary strand of DNA ACGTAACTGGACGTAACTGG

18 ACGTAACTGGTGCATTGACCACGTAACTGGTGCATTGACC

19 Let’s Try One More TG A C A C T A G A T A C C C G T A T C

20 A C T G T G A T C T A T G G G C A T A G


Download ppt "4/20/12 Bell Ringer I'm called by three letters Though I have a long name. I'm in all of you, But I'm never the same. I'm all coiled up So that I am quite."

Similar presentations


Ads by Google