1. I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of angiogenesis Cell signaling, endothelial migration, and zebrafish: a simplified model for angiogenesis Khalid Boushaba, Jeffrey Essner, and Howard Levine Iowa State University

2. Cell signaling, endothelial migration, and zebrafish: a simplified model for angiogenesis

3. Zebrafish as a High-throughput Model for Angiogenesis Research and Therapeutic Development Large number of offspring Optically clear embryos Short generation time Small Size Forward Genetics: ENU mutagenesis Insertional mutagenesis Reverse Genetics: Transgenic fish Tilling with ENU Morpholino injection Genomics: Sequenced Genome cDNA projects Microarrays Small Molecule Screens: Predictive of higher vertebrates Delivery by injection or soaking Carcinogenesis: Aqueous delivery Similar to human tumors

4. Zebrafish embryos are optically clear and develop rapidly From Karlstrom and Kane, 1996

5. From Yancopoulos et al., 2000 Model of Tumor Angiogenesis Novel Angiogenic Factors Candidate Anti-Tumor Agents

6. Advantages of Studying Angiogenesis in Zebrafish Angiogenesis is a conserved vertebrate-specific function Analysis in living embryos 2.7 dpf

7. Transgenic zebrafish allow analysis of endothelial cells in living embryos fli1-egfp transgenic embryo at 2 dpf Dorsal Aorta (DA) Posterior Cardinal Vein (PCV) Intersegmental Vessels (Se) Dorsal Longitudinal Anastomotic Vessel (DLAV) Caudal Vein Capillary Plexus

8. Advantages of Studying Angiogenesis in Zebrafish Microangiography: analysis of blood flow in living embryos

9. The intersegmental vessels form by sprouting angiogenesis

10. ve-cadherin expression identifies primitive endothelial cells in the early zebrafish embryo

11. Primary angiogenesis in the trunk and tail are apparent at 24 hpf ve-cadherin in situ hybridization

12. Each intersomitic vessel is composed of three endothelial cells fli1-egfp transgenic embryo at 2 dpf

13. fli1/gfp embryos allow the behavior of individual cells to be followed during primary angiogenesis Movies from Brant Weinstein’s lab at the NIH

14. Discovery Genomics, Inc. Karl J. Clark Jon Larson Aidas Nasevicius Shannon Wadman Perry B. Hackett Iowa State University Hsin-Kai Liao Ying Wang Danhua Zhang Katie Lutz University of Minnesota Eleanor Chen Stephen C. Ekker Max-Planck Institute - Freiburg Matthias Hammerschmidt Angiogenetics, AB Mats Hellstrom

15. Mechanism of Morpholino Phosphoramidate Inhibition 60S 40S AUGUAG AUGACCGGUAUUAGUCCGGACCUAGAAAAA 40S 60S Inhibition of Translation 40S AUGUAG AUGACCGGUAUUAGUCCGGACCUAGAAAAA 40S MPO Encoded Protein BASEn N P N O O O N O O BASEn+ 1 P N O CH 3 Antisense oligonucleotides Designed as 25 mers Bind tightly Resistant to digestion Low toxicity Not RNAseH mediated

16. Microinjection : An Efficient Morpholio Delivery System Injection Site Nasevicius and Ekker (2000, 2001) Easy to perform: can inject thousands of embryos per day 0 hr 1.5 hrs 4 hrs 28 hrs

17. Microarray Pre-selection vs. Random Selection Discovery Genomics, Inc. /AngioGenetics AB Pilot Screen: Targets were pre-selected based on microarray data. 16% of genes (8/50) were identified as angiogenesis candidates. Random ENU Mutagenesis screens: Genes are mutated randomly with a chemical mutagen in a forward genetic screen (Habeck et al., 2002). Subsequent gene identification is difficult. 0.5% of genes (approximately 1/200) are estimated to affect angiogenesis. DGI/AG Screen 16% Selected Candidates Random Screens Selected Candidates 0.5%

18. Syndecan-2 VEGF/VEGFR1&2 erm1 ? F-actin ? ? erm1 may associate with Syndecan-2 during vascular formation to transmit VEGF-signaling

19. Migration VEGFR2 (flk1) Hypothesis I: endothelial migration is dependent on the concentration of VEGF VEGF

20. The embryonic midline influences vasculogenesis and angiogenesis by inducing VEGF expression Lawson et al., 2001

21. VEGF is required for the correct number of endothelial cells ve-cadherin expression

22. Vasculogenesis is dependent on VEGF in zebrafish embryos WtVEGF MO 3 dpf

23. VEGF-A is required for vasculogenesis in zebrafish Microangiography allows high resolution mapping of mature vessels. Nasevicius et al., 2000

24. Migration of the intersegmental vessels is severely affected in VEGF-A knockdown embryos at 2 dpf WtVEGF-A

25. Migration VEGFR2 (flk1) Endothelial migration is dependent on the concentration of VEGF VEGF VEGFR2 (flk1) VEGF Wt VEGF MO

26. Formation of the intersegmental vessels by sprouting angiogenesis requires VEGF Zebrafish ve-cadherin expression at 48 hpf

27. Planar transcytosis Argosomes Cytonemes Restricted diffusion Gradients can be set up and interpreted in many different ways

28. Migration VEGFR2 (flk1) Endothelial migration is dependent on the concentration of VEGF VEGF VEGFR2 (flk1) VEGF Wt VEGF MO VEGF MO + hVEGF VEGFR2 (flk1) VEGF Migration

29. VEGF and VEGFR2/flk1 VEGF signaling is conserved during zebrafish vascular development In zebrafish there are two flk1 genes: flk1a and flk1b. Simultaneous knockdown of both flk1a and flk1b resembles VEGF-A knockdown embryos.

30. Migration VEGFR2 (flk1) Endothelial migration is dependent on the concentration of VEGF and VEGFR2 VEGF VEGFR2 (flk1) VEGF wt flk1a and flk1b MO

31. Syndecan-2, a heparan sulfate-containing proteoglycan, is essential for angiogenic sprouting of blood vessels Syn2 MO, fli-1WT fli-1 Chen et al., 2004 ? Syndecan-2 VEGF/VEGFR1&2

32. VEGF 121 VEGF 145 VEGF 165 VEGF 183 VEGF 189 VEGF 206 Heparan Sulfate Binding Region Vascular Endothelial Growth Factor A (VEGF-A) Robinson & Stringer, 2001

33. Migration VEGFR2 (flk1) Endothelial migration is dependent on the concentration of VEGF, VEGFR2, and Syndecan-2 VEGF Syndecan2 presenting cells VEGFR2 (flk1) VEGF

34. Syndecan-2 Phosphoserine Growth Factor and Receptor A Cell-autonomous B Cell-autonomous Presentation model Complex model C Cell-nonautonomous, inside-outside signaling model Syndecan-2 may function in multiple ways

35. Migration VEGFR2 (flk1) Endothelial migration is dependent on the concentration of VEGF VEGF VEGFR2 (flk1) VEGF wt VEGF +Syn2 MO VEGF MO + hVEGF VEGFR2 (flk1) VEGF Migration VEGFR2 (flk1) Syndecan2 presenting cells

36. Ectodomain C1V C2 YRMRKKDEGSY DLGERKPSSAAYQKAPTK EFYA EphB2 PKC  Ezrin Synbindin Synectin Syntenin CASK Phosphorylation sites Serines and Tyrosines HS Chains A Ezrin Synectin F-actin B C-terminal cytoplasmic domains

37. Migration VEGFR2 (flk1) Endothelial migration is dependent on the concentration of VEGF and VEGF requires Syndecan2 for signaling VEGF Syndecan2 presenting cells

38. Mass action law

40. Biochemical equations

41. Role of cell cycle and cell movement equations

42. Cell movement

43. Full model equations