1. EMD-5127 – PDB 3IYD Three-dimensional EM structure of an intact activator-dependent transcription initiation complex Hudson, B.P., Quispe, J., Lara-Gonzalez, S., Berman, H.M., Arnold, E., Ebright, R.H., Lawson, C.L. (2009) Proc. National Acad. Sci. USA 106, 19830-19835

2. Funding: NIH GM021589 Catherine Lawson, PI Helen Berman, co-PI Brian Benoff Jens Birktoft Brian Hudson ** Samuel Lara-Gonzalez Andrew Napoli Ramya Rao Kaitlyn Turo http://roma.rutgers.edu Collaborators Rutgers Richard Ebright Eddy Arnold Scripps Joel Quispe Bridget Carragher Clint Potter Acknowledgements

3. 3 components: Activator (50 kDa) RNA polymerase (300 kDa) Promoter DNA (~100 base pairs) Total: ~ 500 kDa Bacterial Transcription Activation

4. Sample Reconstitution CAP (-61.5) +1 CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGT TGTGAGCGGATAACAAG GCGTTATTTACACTAGATCTAGTGTAAAATCCGTTTTTTCCGAAATGTGAAATACGAAGGCCGAGCA ACACTCGCCTATTGTTC -35-10 ATAATCGCACCTTA ATAATCACACCTTA

5. EM Specimen Carbon sandwich stain technique Sample Uranyl Formate Stain Carbon Film Grid Ohi et al, Biol. Proced. Online (2004), 6, 23-34.

6. EM Reconstruction EMAN projection matching thermophilic RNAP starting model yielded density for E. coli- specific insertions at expected positions First refinement cycle projections averages projections averages Particles (~17000 total) Final refinement cycle

7. Resolution Estimation

8. “Class I” Map + Interpretation EMDB ID EMD-5127 PDB ID 3iyd

9. T. thermophilus RNAP holoenzyme from Mukhopadhyay et al., 2008 (PDBid 3DXJ). CAP +  CTD + DNA from Benoff et al., 2002 (PDBid 1LB2),  CTD +  70 region 4 + DNA from Lara et al, manuscript in preparation DNA positions -23 to +20 from Lawson et al., 2004. E. coli  subunit N-terminal domain dimer from Zhang & Darst, 1998 (PDBid 1BDF). E. coli  70 regions 1.2 to 2 from Malhotra et al., 1996 (PDBid 1SIG). E. coli  ’GNCD from Chlenov et al., 2005 (PDBid 2AUK). Initial Model Fitting

10. Coordinate Model Generation Rigid body fitting, multiple models (Chimera) DNA helical path adjusted around -35 element (3DNA) Unified RNAP homology model created (Modeller) Domain-wise fitting (Yup.scx, improved overall map-model correlation coefficient from 0.77 to 0.85) Geometry regularization (phenix.pdbtools)

11. Coordinate Model Quality Phenix.pdbtools geometry regularization: No close contacts RMSD bonds 0.005 Å RMSD angles 0.8 degrees Unrealistic phi-psi angles: 500/4000 residues (12%)

12. “the value of such a reconstruction is … in having a model for E. coli RNAP (which contains significant differences from the thermophilic enzymes) and in providing a framework for testing positions/interactions involving parts of the complex that have not been available previously. “ Reviewer Comment

13. componentAvg. map value at fitted atoms EOTEST maps Shift (Å) EOTEST maps Rotation(°) CAP dimer 3.31.42.9 Tth RNAP 6.00.10.3 RNAP α 2 NTD dimer 7.00.22.8 RNAP σ 70 region 1.2-2 5.80.96.7 RNAP β’ GNCD 3.3n.a. Fitting Statistics

14. Euler Frequency Distribution