1. Gateway cloning system
BP Reaction
LR Reaction

3. Why Gateway No restriction enzymes needed Fast High efficiency
Multiple destination vectors
Site-directed mutagenesis (Empty donor vector is very small ~2.3kb)

4. 1. Design the primers attB1(Foward): GGGGACAAGTTTGTACAAAAAAGCAGGCTTC
attB2(Reverse) GGGGACCACTTTGTACAAGAAAGCTGGGTC

5. 2. BP reaction PCR product need to be recovered from gel. Important!
PCR product ul
pDONR/Zeo ul
BP clonase ul
O/N at R/T
LB+Zeocin (Half salt)

6. 3. Sequencing PCR product+donor vector=Entry clone
Pick 1-2 colonies (no colony PCR needed)
M13f and M13r are used to sequence cloned fragment

7. 4. LR Reaction Entry clone 1ul Destination vector 1ul
LR clonase ul
TE buffer/H2O ul
1 hour at R/T

8. 5. Destination clones Bacterial selection=destination vector
After plasmid isolation, run a gel. Sometimes entry vector will be co-transformed. Make sure there is no bright band of entry vector.
Colony PCR if necessary.

9. Gateway compatible destination vector construction
Insert Gateway cassette in to target Vector.
Three cassettes with corresponding three different reading frames. Decide which one you need. Consider N-/C-terminal fusion.
Blunt ligation. You need check the cassette orientation.
Bacterial selection: chloramphenicol+X
You can only use ccdB survival strains.

10. Currently available destination vectors
pBASTA-35S-GFP-GW
pBASTA-35S-FLAG-GW
pHYG-35S-GFP-GW
pTA7002-GW
pBASTA-GUS-GW
pGTB9BS-GW (New)
pGAD GH-GW (New)
pGEMHE-GW (New)
pGEX4T-3-GW