1. Genomes & their evolution
Campbell & Reece Chapter 21

2. Genomics study of a specie’s whole set of genes & their interactions
bioinformatics: use of computers, software, & mathematical modes to process & integrate biological informationfrom large data sets

3. Human Genome Project sequencing the human genome 1990 – 2003
20 large centers in 6 countries + many other small labs working on small parts of it

4. FISH
Cytogenetic Map: chromosome banding pattern & location of specific genes by flourescence in situ hybridization (FISH)
b/4 Human Genome Project the # of chromosomes & their banding patterns known for many species
some human genes already located

5. FISH
method in which flourescently labeled nucleic acid probes allowed to hybridize to immobilized array of whole chromosomes
maps generated from this used as starting point

6. 3 Stages to Genome Sequencing
Linkage Mapping
Physical Mapping
DNA Sequencing

7. Linkage Mapping
ordering of genetic markers (1000’s) spaced thru-out chromosomes
order & spacing determined by recombinant frequencies
markers: genes, RFLPs, (restriction fragment length polymorphism) or STRs (short tandem repeats)

8. RFLP in gel electrophoresis, fragments of DNA are separated by length
(-) charge of phosphate groups moves DNA thru gel (acting like a sieve) toward (+) end
resulting in: bands that each consist of thousands of DNA molecules of same length

9. RFLP
1 useful technique has been to apply restriction fragment analysis to these bands  information about DNA sequences
restriction enzymes “cut” DNA at known nucleotide sequences then these fragments produced are put thru gel electrophoresis

10. RFLP
DNA can be recovered undamaged from gel bands (so can be used to prepare pure sample of individual fragments)
can be used to compare 2 different DNA molecules (2 alleles of same gene) if nucleotide sequence affects a restriction site: change in even 1 nucleotide will prevent the “cut”

11. RFLP (restriction fragment length polymorphism)
polymorphisms: variations in DNA sequence among a population
this particular type of sequence change is called RFLP (“rif-lip”)
if 1 allele contains a RFLP, digestion with the enzyme will produce a fragment of different length

13. Short Tandem Repeats: STR
technique used by forensic scientists
are tandemly repeated units of 2 to 5 base sequences in specific regions of the genome
# repeats present is highly variable person to person (polymorphic)
1 individual’s may vary if has 2 alleles

14. STR PCR (polymerase chain react is used to amplify particular STRs
quicker technique than RFLP analysis
can be used with less pure samples of DNA or if only have minute sample

15. PCR

16. 3 Stages to Genome Sequencing
Linkage Mapping
Physical Mapping
DNA Sequencing

17. Physical Mapping
ordering of large fragments cloned in YAC & BAC vectors
followed by ordering of smaller fragments cloned in phage & plasmid vectors
key is to make overlapping fragments & then use probes or automated nucleotide sequencing of ends to find the overlaps

18. YAC & BAC 1st cloning vector
Yeast Artificial Chromosome
Bacterial Artificial Chromosome
1st cloning vector
carries inserted fragments million base pairs (bp) long
carries inserts of 100,000 – 300,000 bp

19. Physical Mapping fragments from YAC & BAC put in order
each fragment cut into smaller pieces
which are then cloned in plasmids, ordered, & finally sequenced

20. DNA Sequencing
determination of nucleotide sequence of each small fragment & assembly of the partial sequences into the complete genome sequence
for human genome used sequence machines
sequencing of all 3 billion bps in haploid set of human chromosomes done at rate 1,000 bp/s

21. Human Genome Project
took 13 yrs
$100 million

22. Sequencing an Entire Genome

23. Whole-Genome Shotgun Approach
essentially skips the linkage mapping & physical mapping stages & starts with sequencing of DNA fragments from randomly cut DNA
computers then assemble the resulting very large # of short sequences into a single continuous sequence

24. Shotgun Approach

26. Application of Systems Biology to Medicine
2007 – 2010 set out to find all the common mutations in 3 types of cancer (lung, ovarian, glioblastoma) by comparing gene sequences & patterns of gene expression in cancer cells compared to normal cells

27. Cancer Genes
# genes identified that had been suspect + genes that were not suspected
gives researchers point to develop new treatments aimed these genes
10 more cancers then studied (most common/most lethal)

28. Microarray Chip

29. Genomes Vary in Size, # of Genes, & Gene Density

30. # of Genes Prokaryotic cells < Eukaryotic cells
Humans: expected 50,000 – 100,000 but have found < 30,000
How do we get by with not many more genes than nematodes?
# proteins we have > # genes
vertebrates use alternative splicing of RNA transcripts

31. Gene Density # genes in given length of DNA
eukaryotes generally have larger genomes but fewer genes in given # of bps
humans have 100’s – 1000’s times more bps but only 5 – 15 times as many genes
Sooooo: gene density lower in humans than in bacteria

32. Noncoding DNA includes most of eukaryotic DNA introns
most is noncoding DNA between genes

33. 1.5% of our genome codes for proteins, or is transcribed into rRNA or tRNA

34. Pseudogenes
former genes that have accumulated over a long time & no longer produce functional proteins

35. Repetitive DNA
sequences that are present in multiple copies in the genome
75% of this repetitive DNA (44% of entire genome) is made up of units called transposable elements & related sequences

37. Transposable Elements & Related Sequences
found in both prokaryotes & eukaryotes
stretches of DNA that can move from one location to another w/in the genome
transposition: process where 1 transposable element moves from 1 site to different target site by a type of recombination process

38. “Jumping” Genes

39. Transposons
Gene that is “jumping” never actually completely detach from the cell’s DNA
original and new strands brought together by enzymes & other proteins that bind to DNA
1st evidence came from studying genetics of Indian corn

41. Movement of Transposons & Retrotransposons
2 types of eukaryotic transposons:
Transposons
move w/in genome by means of DNA intermediate
move & paste or cut & paste
both require enzyme transposase (encoded by transposon)

42. Retrotransposon 2nd type of eukaryotic transposable element
move by means of RNA intermediate that is a transcript of retrotransposon DNA
always leave original site during transposition
RNA intermediate is converted back to DNA by reverse transcriptase (enzyme encoded by retrotransposon)

44. Other Repeating DNA
probably arises due to mistakes made during DNA replication or recombination
~14% human DNA
~1/3 of this duplications of long stretches of DNA
segments copied from 1 chromosomal location to another on same or different chromosome

45. Simple Sequence DNA
Contains many copies of tandemly repeated short sequences:
ATTGCGATTGCGATTGCGATTGCG
repeated units can be 2 – 500 nucleotides

46. Short Tandem Repeat (STR)
repeating units that are 2 to 5 nucleotides long
found on telomeres & centromeres (so may play structural role)
# of repeating units can vary w/in same genome and with different alleles
this diversity means STR’s can be used in preparing genetic profiles

48. Other Types of DNA
1.5% of genome: genes that code for proteins, rRNA, tRNA
include introns & regulatory sequences associated with genes total amt is 25% of the human genome

49. Multigene Families <1/2 genes present in 1 copy
multigene families: collections of 2 or more identical or very similar genes
some identical present in tandem, repeats code for an RNA or histone proteins

50. rRNA genes
repeated tandemly 100’s to 1000’s times in 1 to several clusters in genomes of multicellular eukaryotes
helps cells quickly make millions of ribosomes necessary for protein synthesis

52. Multigene Families of Nonidentical Genes
Globins: group of proteins that include the α and β polypeptide subunits of hgb
Chromosome 16 encodes for forms of α-globin
Chromosome 11, encodes for β-globin
different forms are different times in development allowing hgb to function effectively in changing environment of developing animal

54. Fetal-Globin
in fetal stage use this globin because it had higher affinity for O2 ensuring the efficient transfer of O2 from mother

55. Clues to Evolution
by looking at arrangement of genes in gene families get insight into evolution of genomes
genome w/4gene families in 4 species

57. Genome Evolution
“accidents” in cell division can lead to extra copies of all or parts of a chromosome which can then diverge if 1 set accumulates nucleotide sequence changes

58. Genome Evolution
compare chromosomal organization of genomes among species  info about evolutionary relationships
w/in given species rearrangements of genes thought to contribute to emergence of new species

59. Globin Gene
1 common ancestral globin gene  duplicated & diverged into α and β globin ancestral genes
subsequent duplication & random mutation  present day globin genes
all genes along the way code for O2 - binding proteins

62. Globin Genes
some copies of the duplicated globin genes have diverged so much that their functions are now substantially different
examples:
lysozyme: enzyme that destroys bacterial cell walls in mammals, found in sweat, tears, & saliva
α-lactalbumin: protein found in milk, contains all a.a.

63. Gene Evolution
rearrangement of exons w/in & between genes during evolution  genes containing multiple copies of similar exons&/or several different exons derived from other genes

64. Gene Evolution
movement of transposable elements or recombination between copies of same element occasionally creates new sequence combinations that are beneficial to the organism
new combinations can alter function of genes or their patterns of expression & regulation

67. Comparing Genome Sequences
human & chimpanzee sequences show ~4% differences
most due to:
insertions
deletions
duplications

68. 4%

69. FOXP2 Gene gene that affects speech
human & chimp have nucleotide sequence variations

70. SNPs & CNVs Single Nucleotide Polymorphisms Copy Number Variations
variations of both w/in a species can yield information about the evolution of that species

72. Evo-Devo Biologists
Evolutionary Developmental biologists have show that homeotic genes (any of the master regulatory genes that control placement & spatial organization of body parts in animals) & other genes associated with animal development contain a:
homeobox region
has sequence that is highly conserved among diverse species (animals, plants, yeast)

73. Homeobox Genes in Fruit Fly & Mouse

74. Hox Genes
genes or groups of genes that are responsible for the lay out of basic body forms
set up the head-to-tail organization
are general purpose (work in many animal phylums)
small changes in them or the genes that control them would lead to major source of evolutionary change

75. Changes in Expression of Hox Genes have changed over evolutionary time

76. Comparisons of Animal & Plant Development
last common ancestor of plants & animals probably a unicellular eukaryote (100s of millions of years ago)
morphogenesis in plants relies on differing planes of cell division & on selective cell enlargement

77. Comparing Development in Plants & Animals
development relies on a cascade of transcriptional regulators turning genes on/off
Plants do not use Hox genes, they have another group of genes (Mads-box)
can find Hox genes in plants & Mads- box genes in animals but in neither case do they have same major role in development