1. Application of New DNA Sequencing Technologies for the Study of Epigenetic Abnormalities in Breast Cancer John R. Edwards jre13@columbia.edu Columbia Genome Center July 25th, 2007

2. Sequencing by Synthesis A new paradigm in genomic sequencing

3. DNA Polymerase Reaction

4. DNA Polymerase Reaction Modifications

5. G - Linker - O-Block-3’ Sequencing by Synthesis ACGCTAGCGATCATGCAGCTGCATCGACGCTAGCGATCATGCAGCTGCATCG TGCGATCGTGCGATCG Template Primer C A T

6. Structure of the Polymerase-DNA-Nucleotide Complex Pelletier et al. (1994) Science 264, 1891 -1903

7. Ju J, Li Z, Edwards JR, Itagaki Y. U.S. Patent (2003) 6,664,079 DNA Sequencing by Synthesis (SBS) on a Chip

8. J. Ju et al. PNAS, 2006, 103:19635-40. Molecular Structures of 3’-O-Allyl-dNTP- Allyl-Dye Nucleotide Analogues

11. Emulsion PCR Based DNA Template Preparation

12. Methylation Landscape of the Human Genome

13. CpG Methylation and Transcription Jones and Takai (2001) Science 293:1068-70

14. CpG Composition of the Human Genome

15. Fractionation of the Genome

16. McrBC and RE Digests

17. Fractionation and Analysis Pipeline

18. Fractionation Methods Show an Unbiased Coverage of the Genome McrBC = 3073 sequences RE = 2565 sequences

19. http://epigenomics.cu-genome.org/html/meth_landscape/

20. Custom Methylation Tracks on the UCSC Genome Browser

21. Methylation Status of Promoters

22. Alu Elements are Highly Methylated

23. Categorical Breakdown of Methylated and Unmethylated Compartments

24. Methylation Limits the Effective Size of the Genome Small Genome Large Genome

25. Whole-genome Profiling of Breast Cancer

26. DNA Methylation in Cancer M. Esteller (2005) Annual Review of Pharmacology and Toxicology 45:629-656. Genomic Hypomethylation Genomic instability? Activation of proto-oncogenes? Loss of Imprinting?

27. New Tools to Probe DNA Methylation in Breast Cancer Technology Requirements Whole genome approach Must examine state of repetitive elements Unbiased Must be useable for primary tumors Goals Characterize complete methylation profile of breast cancer Compare normal/tumor, tumor/tumor, tumor/cell-line Investigate potential as biomarker Understand patterns of global hypomethylation and regional hypermethylation

28. Whole-Genome Methylation Profiling

29. Acknowledgements Acknowledgements Jingyue Ju Timothy Bestor (Genetics and Development) Nicholas Turro (Chemistry) Victoria Haghighi (Psychiatry) Ju Lab James J. Russo Zengmin Li Lanrong BiXiaoxu Li Shundi ShiDae H. Kim Qingleng MengXiaopeng Bai Bestor Lab Rob Rollins Anne O’Donnell National Human Genome Research Institute/NIH NSF, Packard Foundation