1. A RANDOM GRID BASED MOLECULAR EPIDEMIOLOGICAL STUDY ON EBLV ISOLATES FROM GERMANY C. Freuling 1, N. Johnson 2, D. Marston 2, T. Selhorst 1, L. Geue 1, A. Fooks 2, N.Tordo 3 and T. Müller 1 1) Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, D-16868 Wusterhausen, Germany 2) Veterinary Laboratories Agency (Weybridge), Surrey, United Kingdom 3) Unité de la Rage and Laboratoire des Lyssavirus, Institut Pasteur, Paris, France

2. Objective Molecular characterization of a representive panel of German EBLV isolates Molecular characterization of a representive panel of German EBLV isolates Germany has one of the highest numbersGermany has one of the highest numbers Geographic distribution as a key determination for selection in contrast to random samplingGeographic distribution as a key determination for selection in contrast to random sampling Spatiotemporal correlation to phylogenetic informationSpatiotemporal correlation to phylogenetic information

3. Bat rabies in Europe 1977-2006 N= 831

4. Materials and Methods Application of a random grid with 30 km length Application of a random grid with 30 km length Selection of 1 isolate per grid cell Selection of 1 isolate per grid cell 48 out of 120 isolates selected 48 out of 120 isolates selected Phylogenetic analysis based on complete N- gene sequences Phylogenetic analysis based on complete N- gene sequences

5. Results Identification of EBLV1b isolates from the southwest of Germany Identification of EBLV1b isolates from the southwest of Germany 5776N.seq EBLV1a EBLV1b

6. Results 5776N.seq

7. Results

8. Results

9. Results

10. Results

11. Results

12. Results 35 N N M M G G L L P P Is. No 976 AATTGGAAAGAAAAA ------ AA - CTAACACCACT Is. No 5006 AATTGAAAAGAAAAAGAAAAAAA - CTAACACCACT Is. No 15571 AATTGAAAAGAAAAAGAAAAAAA - CTAACACCACT Is. No 5776 AATTGGAAAGAAAAA ------ AAACTAACACCACT Is. No 3132 AATTGGAAAGAAAAA ------ AAACTAACACCACT short genomic insertions in the 3 UTR of the N – gene 6 bp insertion in EBLV-1b (Johnson et al, 2007) 1 bp insertion in EBLV-1a

13. Conclusions/Discussion Further confirmation of EBLV1b in southern Germany Further confirmation of EBLV1b in southern Germany High sequence homology in N-Gene High sequence homology in N-Gene Indication for geographical clustering of EBLV1a Indication for geographical clustering of EBLV1a No species differences No species differences Identification of short genomic insertions in the 3 UTR of the N-gene Identification of short genomic insertions in the 3 UTR of the N-gene Further research nessesary Further research nessesary Other gene segments (e.g. G, ψ – pseudogene) Other gene segments (e.g. G, ψ – pseudogene) More isolates from different time periods More isolates from different time periods

14. Thanks for attention!!