Presentation is loading. Please wait.

Presentation is loading. Please wait.

Vectors Timothy G. Standish, Ph. D.. Vectors If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then.

Similar presentations


Presentation on theme: "Vectors Timothy G. Standish, Ph. D.. Vectors If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then."— Presentation transcript:

1 Vectors Timothy G. Standish, Ph. D.

2 Vectors If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then make many copies of it Vectors are typically plasmids or viruses that have been engineered to both accept DNA insertions and reproduce inside cells Cloning is the process of inserting DNA encoding a gene of interest into a vector, then establishing it as a stable part of a cell line.

3 2,686 bp pUC 18 A Typical Plasmid Lac Z Gene Multiple Cloning Site aagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattc HindIII SphI PstI SalI XbaI BamHI XmaI KpnI SstI EcoRI AccI SmaI BanII HincII BspMI Origin of Replication Amp r Gene

4 pUC 18 Sequence tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcaggg cgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgt aaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaaggg ggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgactctaga ggatccccgggtaccgagctcgaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtg taaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggcca acgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaa ggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctgg cgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctg gaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaaagctcacgctgtaggtatct cagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaa gacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctaca ctagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttt tgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggatttt ggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaa tcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgc tgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcct ccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgttt ggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagt aagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattct gagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcg gggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagc aaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatga cattaacctataaaaataggcgtatcacgaggccctttcgtc

5 G CTTAA AATTC G 1 Digestion 2 Annealing of sticky ends 3 Ligation Ligase G CTTAA AATTC G EcoRI R. E.s and DNA Ligase Can be used to make recombinant DNA GAATTC CTTAAG GAATTC CTTAAG G CTTAA AATTC G 4 Recombinant DNA

6 Host Cell Cloning Into pUC18 pUC18 LacZ Amp r R. E. Digestion Addition of ligase joins nicks and makes a single recombinant plasmind R. E. Digestion Matching sticky ends anneal Transformation of cells with the recombinant plasmid

7 So How Do You Know If You Cloned Something? IPTG - Induces expression of lacZ X-Gal - A lactose analog which turns blue when split by  -galactosidase Ampicillin - Kills all bacteria that lack the plasmid

8 X-Gal 5-Bromo-4-chloro-3-indolyl  - D -galactopyranoside OH O HOCH 2 HO Glucose O O OH HOCH 2 HO Galactose Lactose O-  - D -galactopyranosyl-(1->4)-  - D -glucopyranose

9  -Galactosidease Lac Z gene product X-Gal 5-Bromo-4-chloro-3-indolyl  - D -galactopyranoside NHNH Br Cl O O OH HOCH 2 HO Galactose X-Gal (Colorless) H2OH2O

10  -Galactosidease X-Gal 5-Bromo-4-chloro-3-indolyl  - D -galactopyranoside OH O HOCH 2 HO Galactose Blue NHNH Br Cl HO

11 So How Do You Know If You Cloned Something? Blue colonies - Express  -galactosidase which metabolizes colorless X-gal to blue and turn blue; thus lacZ is not disrupted and there is no foreign DNA cloned Cloned fragments disrupt lacZ; thus make no b-galactosidase and colonies remain white IPTG - Induces expression of lacZ X-Gal - A lactose analog which turns blue when split by  -galactosidase Ampicillin - Kills all bacteria that lack the plasmid

12 Libraries If all the DNA from an organism is digested with a restriction enzyme and cloned into a plasmid, many different recombinant plasmids will be made, each with a different fragment of DNA cloned into it Once inserted into host cells or viruses, this collection of many different recombinant plasmids is called a “library” When the whole genome of an organism is used as the starting point for cloning, it is called a “shotgun clone” A library constructed using shotgun cloning may contain hundreds of thousands of different recombinant plasmids Screening is the process of sifting through the library to find the clone of interest

13 A Library The clone of interest

14 Strategy Extract DNA Fragment DNA Insert into vector DNA Library in bacteria Screen library and grow up bacteria with clone of interest

15 Library Screening Libraries tend to have a lot of clones, only one of which has the sequence of interest Screening a library is the process of eliminating those clones that do not contain the sequence of interest and locating the clone that does There two major techniques are used for screening: Hybridization screening - In which DNA from a library is bound to a membrane, then the membrane is exposed to a probe that should base pair (hybridize) to the sequence of interest Expression vectors may be used so that if the gene for a protein is cloned, the protein is made. To do this, you must be able to detect the protein

16 cDNA Libraries Because of the large size of libraries and the tedium of screening, anything that can be done to limit library size is a good thing Protein coding regions of most eukaryotic genomes make up only a small percentage of the total DNA (3% in humans) Most cells only express a small subset of an organism’s genes By using reverse transcriptase, a cDNA copies of the mRNA being produced in a group of cells can be made Cloning cDNA to make a library produces a much smaller library enriched with the part of an organism’s genome that is of most interest

17 An Expression Vector II I AatII pPROTet.E SacI t0t0 Myc tag EK site MCS ColE1 Cm r XbaI T1 pPROTet.E is a commercially available plasmid sold by Clontech It is specifically designed to allow efficient control of expression

18 Rev. Trans. TTTTTTTTTTTT5’5’ cDNA Library Construction TTTTTTTTTTTT5’ 5’ cDNA after RNase treatment AAAAAAAAAAA3’5’ mRNA AAAAAAAAAAA3’5’ mRNA cDNA hybrid Insert into vector AAAAAAAAAAA3’5’ Reverse transcription TTTTTTTTTTTT5’5’ Double-stranded cDNA after DNA polymerase RN ase A A A A A A A AAAAAAAAAAA3’5’ DNA Pol

19


Download ppt "Vectors Timothy G. Standish, Ph. D.. Vectors If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then."

Similar presentations


Ads by Google