Presentation is loading. Please wait.

Presentation is loading. Please wait.

Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA.

Similar presentations


Presentation on theme: "Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA."— Presentation transcript:

1 Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA Brian Kreiser University of Southern Mississippi

2 OR Where Are You From & Who’s Your Daddy ?

3 A Brief Introduction Kreiser & Colleagues Kevin Feldheim - The Field Museum Wilfredo Matamoros - USM Jake Schaefer - USM Moyer & Colleagues Brian Sloss – USGS Josh Rousey – Valdosta State Justin Sipiorski - SIU

4 Samples in Hand MS Gulf Coast Fishing Rodeo (2002+) - Dennis Riecke (MDWFP) St. Catherine Creek NWR - Ricky Campbell (UWFWS) Vicksburg - Jan Hoover (Army Corp) Oklahoma - Kerry Graves (USFWS) Louisiana - Allyse Ferrara (Nichols State U.) Texas - Mark Malfa (bowfishing guide) Choctawhatchee - Frank Parauka (USFWS) Other gar species (spotted, longnose, shortnose, Florida)

5 Overview 1.Background on conservation genetics, molecular tools and microsatellites 2.Summary of work to date 3.Future directions - your input

6 Conservation Genetics Fields of - Ecology, Population Genetics & Systematics Tools of - Molecular Biology & Mathematical Modeling

7 Overlapping Questions

8 What is genetic variation and why is it important? All the variation due to differences in alleles and genes in an individual, population, or species Raw material for adaptive evolutionary change –Genetic diversity is required for populations to evolve in response to environmental changes 1 –Heterozygosity levels are linked directly to reduced population fitness via inbreeding depression 2 1 McNeely et al. 1990; 2 Reed and Frankam 2003

9 What is genetic variation and why is it important? Conservation plans –maintain self sustaining populations –... long-term viable populations What does viability and self-sustaining actually mean? A viable population must be large enough to maintain sufficient genetic variation for adaptation to environmental changes

10 The Molecular Markers Mitochondrial DNA Microsatellites Species Boundaries Population Structure Within Populations

11

12 Screening for Genetic Variation Microsatellite gel run

13 Not Really That Complicated Kreiser Lab Not the Kreiser Lab

14 Why Mitochondria? “Powerhouse of the cell”; with its own genome Small, circular genome High mutation rate Variation for population studies Clonal Maternal inheritance

15 Microsatellites - DNA Fingerprinting Many loci in genome Highly polymorphic

16 Example: - (CA) repeat - 6 alleles #2 Genotype = 148 bp / 146 bp - one repeat unit difference #8 Genotype = 144 bp / 156 bp - six repeat units difference Microsatellites - DNA Fingerprinting #5 Genotype = same

17 Multilocus genotype = the DNA fingerprint Microsatellites - DNA Fingerprinting IndividualLocus 1Locus 2Locus 3Locus 4 #2148/146160/156220/212138/130 #5148/146158/156218/210140/136 #8144/156160/158224/220142/132

18 Microsatellite Marker Development Collaborative effort among agencies, universities and laboratories Goal –Develop a suite of 12-16 markers for estimating population genetic parameters

19 Microsatellites - Isolating Loci (GCC) (AT) (GATA) DNA Extraction Enrichment Clone Sequence Clones Select Loci Bearing Clones

20 Microsatellites - Isolating Loci TATTCCAAGGTGCAGCTGTAAGAATGCCATACAAACAAACAAACAAACAAACAAAC AAACAAACAAACAAACAAACAACTCACTCTTCTGAGCTAAAATTCTGTGCTGTCTGTT TTGGGTGAAAACTAGGGAGTTTGCAGAACTCTTTGAGAGTTTTTTTAAGGTGCACATAA AAACTTCATCAGGATCTGAAACACCGTCACTGTGCTGGCTTCCCATTAACCAATATCTG TTTCCTC Atsp 84 - primer design 16 alleles Atsp 159 4 alleles Atsp 12 1 allele

21 Results Moyer lab (lots of work and nothing to show for it!) –Two libraries constructed (enriched for di and tri repeats) –24 primers sets developed and optimized –14 of 24 loci -- successful and consistent amplification of alligator gar DNA –Limited variation 5 loci limited to 1 allele 7 loci had 2 alleles 2 loci had 3 alleles –Cross species amplification with L. osseus, oculatus, platostomus, tropicus, and platyrhincus Similar results

22 Results Kreiser lab - Alligator gar 19 individuals - MS Gulf Coast fishing rodeo 30 loci tested 14 - not resolved 16 - amplified 5 - monomorphic (one allele) 11 - polymorphic (no deviation from HWE or LD)

23 Loci Testing Locus# AllelesHoHe Atsp 740.2630.238 Atsp 3530.7500.627 Atsp 4040.6840.620 Atsp 5440.3160.614 Atsp 5720.0530.051 Atsp 6640.8420.658 Atsp 84160.9470.898 Atsp 9530.4440.545 Atsp 12230.3890.329 Atsp 15940.5260.597 Atsp 34130.6880.506 Average4.50.5370.517

24 Loci Testing Other gar L. oculatus (n=14) & L. osseus (n=13) - Pascagoula 30 loci tested 12-13 - not resolved 7-8 - amplified 2-4 - monomorphic 4-5 - polymorphic (no deviation from HWE or LD)

25 Loci Testing # Alleles LocusL. oculatusL. osseus Atsp 12*32 Atsp 4013 Atsp 5411 Atsp 5767 Atsp 661310 Atsp 9588 Atsp 324*1NR Atsp 339*11

26

27 Where do we go from here?

28 Restoration Goals Ecological –Supplement existing populations –Establish new populations –Ecological functions Genetic –Maintain/restore adaptive diversity and evolutionary processes to promote population persistence. Adaptive genetic variation within populations Genetic structure among populations Historical –Restore the past? –Ensure the future?

29 Strategies for ecological restoration Wait and see Restore habitat –Goal is simply to enhance natural recruitment –No intended or unintentional genetic impact Hatchery-based enhancement –Goal is to increase numbers –No intentional genetic impacts –Unintentional impacts depending on the source of brood stock, how it’s managed, and the natural genetic structure Genetic Rehabilitation –Goal is to “improve” the genetics of populations Manipulate gene flow Selectively bred or genetically engineered brood stock

30 Conservation Genetics & Hatchery Propagation Best choice is local brood stock Non local –Risk – outbreeding depression (relative fitness of hybrids and back crosses < natural population) –Does genetic similarity = adaptive similarity? –Can have high gene flow but local adaptation Recommendation –Avoid non-local brood stock –Test for adaptive vs. neutral genetic variation

31 Conservation Genetics & Hatchery Propagation Local brood stock –Genetic diversity Hatchery ≈ natural Risk: inbreeding depression –Lower relative fitness of hatchery stock Recommendation – Genetic baseline data –Large number of unrelated founders – number depends on generation time of organism –Spawn unrelated –Avoid spawning brood stock more than once –Use brood held in captivity < 1 generation 1 –Equalize parent contributions –Rearing conditions Hatchery ≈ natural Risk: artificial selection –Lower relative fitness of hatchery stock Recommendation –Equalize parent contributions 1 Araki et al. 2007 Science

32 Questions/Suggestions?

33


Download ppt "Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA."

Similar presentations


Ads by Google