1. Tomato Genome Sequencing: Indian Contribution on Chromosome 5

2. International Tomato Genome Sequencing Project 70 µm 0 µm 123 456789101112 108.0 Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5 Mb 64.7 Mb 76.4 Mb 2426 191220271716101311 Mb T=220 246268274193111213277175164108135113 BACs T=2276 Euchromatin Heterochromatin To sequence Chromosome Country USAKoreaChinaUKIndiaNLFranceJapanSpainUSAChinaItaly

3. Indian Initiative on Tomato Genome Sequencing University of Delhi South Campus Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma National Research Centre on Plant Biotechnology Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad National Institute for Plant Genome Research Debasis Chattopadhyay Sabhyata Bhatia Centromeric Region Heterochromatic Region Euchromatic Region Telomeric Region UDSC & NIPGR NRCPB (0-60 cM) (69-119 cM)

4. Criteria for BAC selection and confirmation 1.Selection of two candidate seed BACs on chromosome 5 specific marker 100 kb or more in size end sequence availability at SGN 4. BAC verification by direct sequencing using two marker/overlapping region-specific primers using vector-specific SP6 and T7 primers 2. Purity check of bacterial stock Hind III fingerprint of DNA isolated from six independent colonies 3. PCR amplification of genetic markers/overlapping region two marker/overlapping region-specific primer pairs 5. Size estimation/confirmation of BAC clone by CHEF analysis of Not I digested BAC DNA 6. Validation of BAC on chromosome 5 using Introgression Lines polymorphism in PCR products SNP detection of non-polymorphic bands

5. Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker: CT101 Seed BAC: LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2: TGTATACTTGCGCCAGTTCAGGG L. esculentum L. pennelliiIL 5-1IL 5-2IL 5-3IL 5-4IL 5-5 Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82)

6. Confirmation of markers and their assigned seed BAC positions on chromosome 5 cMMarkerAmplicon sizeHaplotypes Sequence 0CT1011100 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 -ACCCCTCAATATTTCGCTCCAA TGTATACTTGCGCCAGTTCAGGG L. pennellii, IL5-1 7C2At1g602001000 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 TAGATATGGT CTACCGA-AC L. pennellii, IL5-1 10 cLET-8-B23 (BAC-specific, non-marker region) 360 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 GGCT-TTTAA--ATCTGCATTI/DGTTTCA AAAATCAAGGTTGCGGATGCC...ACCAT- L. pennellii, IL5-1 11T05641200 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 GTAG-GCTCGGCCACCTAT--GAGAGGT-- ACGAA-GATAAGGCTGGGGTAACTGCACTC L. pennellii, IL5-1 15.5cLED-8-G31000 bp M82, IL5-3, IL5-4, IL5-5 CTCG...GTTTT-...TGA-TAAGTTTGAA TGAAI/DACAAATI/DCTGGGGCACACTGG L. pennellii, IL5-1, IL5-2 37C2_At2g01110750 bp M82, IL5-1, IL5-3, IL5-4, IL5-5 TATCAA-G-CTTGACTGTT ATCGGCTAAACATGTCTAG L. pennellii, IL5-2 44C2_At3g55120450 bp M82, IL5-1, IL5-3, IL5-4, IL5-5 TGGTACCCAA GAACGA---T L. pennellii, IL5-2 51 C2_At4g24830 (BAC-specific, non-marker region) 600 bp M82, IL5-1, IL5-3, IL5-4, IL5-5 GCACGC--AATTGCAATCTTTG ATGTAAACCGCCATG---AACA L. pennellii, IL5-2 57T16402300 bp M82, IL5-1, IL5-3, IL5-4, IL5-5 CTAATCATCCA ACTTCTGCAGG L. pennellii, IL5-2 54-60 TES0062 (BAC-specific, non-marker region) 550 M82, IL5-1, IL5-3, IL5-4, IL5-5 TTGTGGGTTGTG -----AACCCGT L. pennellii, IL5-2 60 TG 96 (BAC-specific, non-marker region) 400 bp M82, IL5-1, IL5-3, IL5-4, IL5-5 TCCAT...C CTACCI/DG L. pennellii, IL5-2 CAPS LE_HBa0042L17_ SP6 600 M82, IL5-1, IL5-4, IL5-5 CTAATACA ACGTGTTT L. pennellii, IL5-2, IL5-3 CAPSLE_HBa0073P05 M82, IL5-1, IL5-3, IL5-4, IL5-5 AC---------ACA GTCTCATCAAAGGT L. pennellii, IL5-2

7. Chr 5 TG623 (8 cM) + CT53(13.5cM) IL5-1 IL5-2 M82 L. pennellii IL5-1 IL5-2 C2_At1g26810 (23 cM)C2_At1g30110 (25 cM) Fine mapping of IL5-1 boundaries TG432 (21 cM) + CT167 (30 cM) - CT101 (0 cM) + C2_At1g26810 (23 cM) + C2_At1g30110 (25 cM) - Haplotype 1: AGAGTAGGTTCCATT Haplotype 2: GAGTACG------CC Haplotype 1: M82, IL 5-1, IL 5-3, IL 5-4, IL 5-5 Haplotype 2: L. pennellii, IL 5-2 CT167 (30 cM)CT101 (0 cM) Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2: TGTATACTTGCGCCAGTTCAGGG Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5 Haplotype 2: L. pennellii, IL 5-1 M82 L. pennellii IL5-1 IL5-2 Modified Original

8. Identification of new markers on tomato chromosomes using CAPS 100 bp ladder Chromosome 8Chromosome 9Chromosome 10Chromosome 11Chromosome 12 Chromosome 3Chromosome 4 Chromosome 5 Chromosome 6Chromosome 7 Chromosome 1Chromosome 2S. pennellii S. lycopersicum 1 kb ladder 13 cM IL5-1 IL5-2 IL5-3 IL5-4 IL5-5 100 bp ladder 1 kb ladderIL 5-3 IL 5-4 IL 5-5 IL 5-1IL 5-2S. lycopesicum S. pennellii S. lycopersicum S. pennellii S. lycopersicum S. pennellii S. lycopersicum S. pennellii Loss of site Mapping marker in different DNA poolsFine mapping to an IL-bin 43 cM Chr. 5 CAPS designing

9. New BACs mapped on tomato chromosomes using CAPS markers 735496 313674 IL-bin Mapping completed for 50 BACs

10. 119 cM Chromosome 5 0 cM 60 cM UDSC + NIPGR NRCPB Mapping of BAC clones on chromosome 5 using FISH 11 cM 37 cM 43.7 cM 46 cM 73 cM 84 cM ? cM BAC: LE_HBa0189E17 Marker: T0564 (11 cM) BAC: LE_HBa0298C03 Marker: TG69 (60 cM) BAC: LE_HBa0169M21 Marker: T1360 (73 cM) BAC: LE_HBa0138J03 Marker: T1746 (84 cM) BAC: LE_HBa0251J13 Marker: TG185 (119 cM) BAC: LE_HBa0309L13 Marker: C2_At2g01110 (37 cM)

11. Single streak of BAC clones from seed BAC library DNA extraction PCR with genetic marker for re-confirmation CHEF-analysis for size estimation Shotgun cloning and sequencing Searching for STCs (Sequence Tag Connector) SGN end- sequence database DNA fingerprinting (HindIII-digested) for BAC stock purity The path for genomic sequencing 1 TACGTG...TTAT 2 CGAACAI/DGACA IL-mapping for chromosome 5-specificity Polymorphism in PCR (digested) products presence of SNP/indels Assembly of sequence BAC annotation Overgo hybridization Selection of extension BAC Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1

12. 0 10 15.5 UDSC & NIPGR NRCPB 11 7 37 44 60 57 51 LE_HBa0132D03 LE_HBa0191B01 LE_HBa0261K11 LE_HBa0042B19 LE_HBa0179E24 SL_MboI0037H06 SL_MboI0005B15 SL_MboI0050C14 LE_HBa0189E17 SL_MboI0095J08 SL_EcoRI0122H05 SL_MboI0004P04 SL_EcoRI0101I15 SL_EcoRI0086I08 LE_HBa0115F01 LE_HBa0309L13 SL_EcoRI0082N07 LE_HBa0298C03 SL_MboI0079D24 SL_EcoRI0028N03 SL_EcoRI0037P02 LE_HBa0147F10 SL_MboI0079C22 LE_HBa0057G22 SL_MboI0118J08 LE_HBa0207N23 LE_HBa0161A14 LE_HBa0023M16 SL_Mbo0115G01 LE_HBa0193P17 SL_EcoRI0114E01 LE_HBa0190L02 LE_HBa0205O12 SL_MboI0129F09 SL_EcoRI0087C17 LE_HBa0013K15 LE_HBa0073P05 SL_MboI0060C10 LE_HBa0031K11 LE_HBa0042L17 SL_MboI0101E05 LE_HBa0018K09 LE_HBa0059E05 SL_EcoRI0077B22 SL_EcoRI0064A20 LE_HBa0224J02 LE_HBa0060G21 LE_HBa0003C20 LE_HBa0058L13 LE_HBa0145P19 LE_HBa0168M18 SL_EcoRI0066O01 SL_EcoRI0125O05 LE_HBa0056N10 LE_HBa0169M21 LE_HBa0201O22 SL_MboI0076A17 LE_HBa0135A02 LE_HBa0050A12 LE_HBa0009H01 LE_HBa0138J03 SL_MboI0093K24 LE_HBa0152J14 LE_HBa0065K15 LE_HBa0011D08 LE_HBa0166A02 LE_HBa0040C21 LE_HBa0047J14 LE_HBa0210G09 LE_HBa0025A19 LE_HBa0131D04 LE_HBa0066P15 LE_HBa0142A20 LE_HBa0196G23 LE_HBa0141A12 LE_HBa0239D11 SL_EcoRI0019P03 LE_HBa0251J13 LE_HBa0089M06 LE_HBa0076P16 SL_MboI0084G04 SL_EcoRI0057J03 LE_HBa0099K13 LE_HBa0107A04* 61 119 115 108 107 105 102.5 84 76 73 E C H E H Sequencing status of BACs on chromosome 5 Phase I Phase II Phase III Library * Sequenced by China

13. BACsKnownPutativeExpressedNo evidence Total predicted genes 4137410170117734 5% 56% 23% 16% Known genes Putative genes Expressed genes No evidence genes Gene prediction & annotation of some sequenced BAC clones

14. Important genes present on some BAC clones BAC cloneName of the GeneOrganism LE_HBa0191B01Putative cytochrome P450O. sativa SL_EcoRI0101I15 Cysteine-rich receptor-like protein kinase 2 precursor A. thaliana SL_MboI0005B15ATP-binding protein At1g60440L. esculentum SL_EcoRI0086I08 Quinone oxidoreductase-like protein At1g23740,chloroplast precursor A. thaliana LE_HBa0261K11 Splicing factor PWI containing protein/RNA recognition motif L. esculentum LE_HBa0042B19Nematode resistance-like protein (Gro1-6)S. tuberosum LE_HBa0179E24Tospovirus resistance protein C (Sw5-C)L. esculentum SL_MboI0037H06UV-damaged DNA-binding protein 1 (hp1)L. cheesmanii LE_HBa0207N23Chaperone protein dnaJ 15A. thaliana SL_MboI0118J08 3-isopropylmalate dehydrogenase, chloroplast precursor Brassica napus SL_EcoRI0028N03cf-9 resistance gene clusterL. pimpinellifolium SL_EcoRI0122H05Omega-3 fatty acid desaturase geneL.. esculentum LE_HBa0309L13Sbt3 geneL. esculentum SL_EcoRI0037P02 ATP synthase beta chain, mitochondrial precursor A. thaliana

15. Mining of important classes of genes using tomato ESTs 123456789101112 04410431104234312103 13 0106001203090411070003 000500 07010201 00 04 001602 00 010302000100 Chromosome Transcription factors Disease resistance genes Defence response-like Lectins Total no. of TF:1463 Mapped:237 (16%) Total no. of R-like genes:238Mapped: 80 (33%) Total no. of lectins:71 Mapped:27 (38%) No. of Unique assembled ESTs – ~48,000

16. Functional annotation of predicted proteins by BLASTP (ITAG) EugeneSwiss-Prot 10 20 30 40 60 70 80 50 90 100 Proteins TrEMBL Percentage 9977 3722 6562 5680 3299 37.3% TAIRRAP 5428 5411 54.4% 54.2% 65.7% 56.9% 33.1% RefSeqNo hit Similar to (between e -100 and e -5 ) Putative (<e -100 ) Known (identical) No evidence Expressed (<e -5 ) 0.2% 20.0% 46.8% 13.1% 19.9%

17. Number of genes per 10 kb sequence Predictions BLASTP hits Functional annotation of predicted proteins Eugene TAIR RAP Swiss-Prot Ref-Seq TrEMBL

18. Highlights 4. Current status of BAC clones from chromosome 5, selected for sequencing * Thirty one BACs are completed (all submitted to NCBI and SGN) * Thirty one BAC clones are in phase II * Thirteen BAC clones are in phase I * Eight BAC clones are at various stages of library preparation and sequencing 3. Eighty three BAC clones covering approximately ~8.0 Mb region on chromosome 5, have been mapped 2. Ten BAC clones have been mapped on chromosome 5 by FISH 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 5. Twelve clones, previously mapped to chromosome 5 have now been confirmed on other chromosomes. 6. Designing of CAPS markers using BAC ends in process. 7. BLASTP analysis as part of functional annotation of tomato genome as part of ITAG.

19. Contributors Prof. Akhilesh K. Tyagi Prof. J. P. Khurana Prof. P. Khurana Dr. A. K. Sharma Dr. Saloni Mathur Dr. Shailendra Vyas Mr. Amol Solanke Mr. Rahul Kumar Dr. Vikrant Gupta Ms. Rashmi Jain Mr. Rupesh K Jain Mr. Shaji Joseph V Dr. Nagendra K. Singh Dr. T. Mohapatra Dr. T. R. Sharma Dr. K. Gaikwad Mr. Awadhesh Pandit Dr. Pradeep K. Singh Mr. A. Kumar Dr. Rekha Dixit Dr. Archana Singh Mr. Vivek Dalal Dr. Manju Singh Dr. I. A. Ghazi Dr. Debasis Chattopadhyay Dr. Sabhyata Bhatia Dr. S. Dewan Ms. P. Chowdhury Ms. S. Shridhar UDSCNRCPBNIPGR IITGS