1. PoBoL – in 5min Michal Galdzicki 7/26/2009

2. Provisional BioBrick Language (PoBoL) Pobol also means “people” in Welsh Proposed information exchange standard Community effort Structured Data Format Modular

3. Modular architecture to encourage re-use, maintenance and evolution Extensible Different authors Independent evolution Explicit differences Protein Parts RNA Parts Dynamic Models SBML

4. PoBoL Structure Based on the Standard Biological Parts Registry layout Specific – Terminology – Structure 7 Classes BioBrick Basic BioBrick Composite BioBrick Vector BioBrick is-a BioBrickFormat Sample DNA

5. Structure illustrated through Canton, et al. ‘08 example BBa_F2620 subPart: BBa_R0011 BBa_B0012 BBa_C0062 BBa_B0010 BBa_R0040BBa_B0034 BBa_F2620 http://partsregistry.org/Part:BBa_F2620 BBa_I0462 subPart:

6. PoBoL aims to represent minimal BioBrick™ information BBF RFC 31: Provisional BioBrick Language (PoBoL) doi: 1721.1/45537 BioBrickFormat: 102325 BioBrickBasic: BBa_R0011 BBa_B0012 BBa_C0062BBa_B0010 BBa_R0040BBa_B0034 21 BioBrickComposite: format subPart BBa_F2620BBa_R0011 BioBrickBasic: DNAsequence acctgtaggatcgtacaggtttacgc aagaaaatggtttgttatagtcgaat aaa shortDescription Promoter activated by LuxR in concert with HSL author Vinay S Mahajan, Voichita Marinescu, Brian Chow, Alexander Wissner- Gross and Peter Carr … DNAsequence tccctatcagtgatagagattgacatccctatcagtga tagagatactgagcactactagagaa… 1061bp shortDescription receiver for bacterial signals …

7. PoBoL is a BioBrick™ semantic model Relationships between Individual BioBricks Explicit assumptions regarding the intended meaning BioBrickBasic BioBrickComposite BioBrickVector BioBrick BioBrickFormat C0062 B0010 B0012 is-a Sample DNA is-a vector insert B0034 I0462 pSB1A2 Assembly Standard 10 format DNA55 Sample56 contains subPart

8. Conforms to W3C information technology standards Semantic Web Standards Common Ontology – Concerned with definition of meaning – A formal specification of the domain Web Ontology Language (OWL) – Access layer – XML -> RDF -> OWL

9. Compliance with W3C grants ability to read, manipulate, and interpret APIs for: Java, Perl, Python, PHP, Ruby, Javascript,.Net / Mono,C, C++,Lisp, Prolog For example: OWL API, Jena Management of model structure Protégé Check consistency and infer data types Pellet

10. History – Spring ’08 Standards and Specifications in Synthetic Biology Workshop – Volunteer Work : pobol.org; pobol Google Group – May 2009 – BBF RFC 31 released – Since: Comments & proposed extensions – Future: Leveraging OWL-DL

11. RBSCDSProtein Generator BioBrickBioBrickFormat hasFormat DNA hasBackbonehasInsert Sample hasDNA DNA Parts Tree Composition Inheritance Legend DNA Part hasPart Promoter Plasmid Backbone Extending /changing PoBoL http://bbf.openwetware.org/RFC.html#BBF_RFC_31:_Provisional_BioBrick_Language_.28PoBoL.29 Slide from: Alec Nielsen proposed update to the document linked below &