Presentation is loading. Please wait.

Presentation is loading. Please wait.

Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon Laboratories of America.

Similar presentations


Presentation on theme: "Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon Laboratories of America."— Presentation transcript:

1 Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon Laboratories of America

2 Why Impedimetric Detection? Z Functionalized sensor – prior to analysis Target analyte species bind to sensor – impedance changes in real time Analyte injection Advantages: Label-free, real-time and rapid detection; Inexpensive devices; Local company (Camas, WA).

3 New v3.0 sensor array format to test Project Aims: #1 SH (thiol) Au Ready for nucleic acid assay Sensor array surface functionalization New SLA READER Measures 15 channels simultaneously Eight impedance measurements per second per channel. Sensor temperature control. DNA oligonucleotide Sensor array with reaction chamber attached

4 Detection of all E. coli strains using probes for a housekeeping gene adenylate kinase (ADK); Detection of enteropathogenic E. coli isolates using virulence genes, hemolysin A (HlyA), and shiga toxin 2 (Stx2). Project Aims: #2 Development of genomic assays common commensal (laboratory K12) MG1655: adk gene only; uropathogenic clinical isolate CFT073: adk and hlyA genes; enterohemorrhagic (O157:H7, food poisoning) EDL 933: adk and stx2b genes. E. coli strains

5 ADK probe: TGGAGAAATATGGTATTCCG HlyA probe: TGAATTCCAGAAGCAAGTCT Stx2b probe: GCGGTTTTATTTGCATTAGT Target preparation: 1 Primer2 Primer PCR Amplicon Template E. coli genomic DNA Probe binding part Project Aims: #2 Probes: Array functionalization

6 95 o C for 5 min PCR amplicon Target preparation in detail: Target types: 500 400 300 200 75 hlyA targets ds ss Double-stranded (dsDNA) Single-stranded (ssDNA) PCR amplicon exonuclease digestion Simple and fast Standard, more sensitive? extra purification

7 dsDNA test: Assay development Goals: to optimize conditions and to compare to the ssDNA test in terms of sensitivity (detection limit), specificity, and dynamic range. Assay parameters:testedselected Target concentration 2.5 and 0.5 µg/ml0.5 µg/ml Buffer (SSPE) concentration 1x, 2x, 4x2x Voltage (excitation potential) 40, 75, 100, 150 mV75 mV Temperature47, 52 o C52 o C?? For almost ALL tests Stx negative control demonstrated negligible signal. Hly negative control response minimization was the major challenge for assay optimization.

8 = ADK; specific = HlyA; neg. = Stx2; control Baseline Sample injection Parallel Injection of Targets

9 Hly buffer ADK Sequential injection of targets to the same sensor arrays: HlyA

10 Stx buffer ADK Sequential injection results: Stx2

11 Conclusions dsDNA target preparation Optimized conditions Demonstrated specific detection using ADK-functionalized sensor arrays Still to do: Compare ssDNA and dsDNA targets

12 Acknowledgements Mariya Smit Andrei Ghindilis Holly Simon Chris Brow Simon/Haygood/Tebo Labs Vanessa Green CMOP SLA: Kevin & Carmen NSF


Download ppt "Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon Laboratories of America."

Similar presentations


Ads by Google