1. PFGE and Beyond: PulseNet in the Next Decade Bala Swaminathan, Ph.D. Centers for Disease Control and Prevention

2. Why Next Generation Subtyping Methods? PFGE (and other RFLP-based methods) are difficult to standardize PFGE (and other RFLP-based methods) are difficult to standardize Comparability of patterns within and between laboratories requires strict adherence to a standard protocol Comparability of patterns within and between laboratories requires strict adherence to a standard protocol Normalization of patterns is complex Normalization of patterns is complex PFGE is labor-intensive and requires high concentrations of a pure culture PFGE is labor-intensive and requires high concentrations of a pure culture In some instances or for some pathogen groups, discrimination may not be adequate In some instances or for some pathogen groups, discrimination may not be adequate

3. Clinical isolate clusters with no demonstrable epidemiologic links – Example 1

4. Clinical isolate clusters with no demonstrable epidemiologic links – Example 2

5. Requirements for the next generation subtyping method for PulseNet Broad applicability Broad applicability Rapid results (< 24 h) Rapid results (< 24 h) Inexpensive Inexpensive Better discrimination than PFGE Better discrimination than PFGE Quantitative relatedness between strains Quantitative relatedness between strains Accurate snapshot of the genome diversity Accurate snapshot of the genome diversity Backward compatibility with PFGE data Backward compatibility with PFGE data Easy to perform on a routine basis Easy to perform on a routine basis Amenable to automation Amenable to automation Results should be readily comparable within and between laboratories Results should be readily comparable within and between laboratories..............

6. Methodologic Approaches  Multi-locus sequence typing (MLST)  Multi-locus Variable-Number Tandem Repeat Analysis (MLVA)  High throughput SNP analysis

7. Based on the nucleotide sequence of internal regions of housekeeping loci Based on the nucleotide sequence of internal regions of housekeeping loci Housekeeping loci should be conserved with only minimal nucleotide changes due to conserved protein function Housekeeping loci should be conserved with only minimal nucleotide changes due to conserved protein function Multiple loci are targeted in this subtyping method Multiple loci are targeted in this subtyping method Sequence variation allows for the assignment of alleles Sequence variation allows for the assignment of alleles Isolate A – ATTCGGCAT – allele 1 Isolate B – ATTCGCCAT – allele 2 A combination of alleles for all loci provides an allele profile which can then be assigned to a sequence type (ST) A combination of alleles for all loci provides an allele profile which can then be assigned to a sequence type (ST) Isolate A (1, 5, 6, 3, 4, 3, 1)ST-5 Isolate B (1, 5, 6, 3, 3, 3, 1)ST-51 Sequence types are grouped into clonal complexes based on similarity to a central allelic profile Sequence types are grouped into clonal complexes based on similarity to a central allelic profile Multi-Locus Sequence Typing

8. Subtyping Campylobacter jujuni Three published MLST schemes Three published MLST schemes Dingle at al (2001) Dingle at al (2001) 194 isolates 194 isolates 155 sequence types 155 sequence types 51 unique ST’s 51 unique ST’s Suerbaum et al (2001) Suerbaum et al (2001) 32 isolates plus NCTC 11168 32 isolates plus NCTC 11168 31 unique allele profiles 31 unique allele profiles Frequent recombination Frequent recombination Manning et al (2003) Manning et al (2003)

9. Origin of replication 1,641,481 bp asp gln glt gly pgm tkt unc ddlA asd eftS fumC yphC nuoH atpA MLST loci

10. Subtyping Campylobacter jujuni Sails et al (2003) Comparison of MEE, MLST and PFGE Comparison of MEE, MLST and PFGE MLST is not as discriminatory as PFGE MLST is not as discriminatory as PFGE MLST plus a variable locus MLST plus a variable locus MLST and flaA SVR provides similar discrimination to PFGE MLST and flaA SVR provides similar discrimination to PFGE

11. MLST studies with enterics Listeria monocytogenes: Additional variable gene targets need to be included in MLST (MLST+) to obtain acceptable discrimination Listeria monocytogenes: Additional variable gene targets need to be included in MLST (MLST+) to obtain acceptable discrimination Cai et al. 2002 Cai et al. 2002 Zhang et al. 2004 Zhang et al. 2004 Salmonella enterica (Kotetishvili et al, 2002) Salmonella enterica (Kotetishvili et al, 2002) MLST is more discriminatory than PFGE MLST is more discriminatory than PFGE Escherichia coli (Whittam Laboratory) Escherichia coli (Whittam Laboratory) Distinguish pathovars of E. coli/Shigella groups Distinguish pathovars of E. coli/Shigella groups Distinguish clonal lineages within pathovars Distinguish clonal lineages within pathovars E. coli O157:H7 is too clonal for MLST subtyping (Noller et al, 2003) E. coli O157:H7 is too clonal for MLST subtyping (Noller et al, 2003)

12. Multilocus VNTR Analysis (MLVA) MLVA (Multi Locus VNTR Analysis) MLVA (Multi Locus VNTR Analysis) Variable Number Tandem Repeats (VNTRs) Variable Number Tandem Repeats (VNTRs) Conserved repeat motif found in the genome Conserved repeat motif found in the genome Example: TAACCG Example: TAACCG Variable numbers of repeat units among isolates of the same species Variable numbers of repeat units among isolates of the same species MLVA examines the number of repeats at multiple loci to determine genetic relationships MLVA examines the number of repeats at multiple loci to determine genetic relationships TAACCG TAACCGTAACCG TAACCGTAACCGTAACCGTAACCGTAACCG TAACCGTAACCGTAACCGTAACCG Isolate A Isolate B Isolate C Isolate D

13. Development of E. coli O157 MLVA protocol Contract awarded to the Massachusetts Department of Public Health / State Laboratory Institute in fall 2001 Contract awarded to the Massachusetts Department of Public Health / State Laboratory Institute in fall 2001 Collaboration with Dr. Paul Keim (The Northern Arizona University) Collaboration with Dr. Paul Keim (The Northern Arizona University)

14. Development of E. coli O157 MLVA protocol (cont’d) Keys, C., S. Kemper, and P. Keim. 2005. Highly diverse variable number tandem repeat loci in the E. coli O157:H7 and O55:H7 genomes for high- resolution molecular typing. J. Appl. Microbiol. 98: 928-940.  29 VNTR loci polymorphic in O157:[H7] serotype identified

15. Development of E. coli O157 MLVA protocol (cont’d) MA protocol based on 25 VNTR loci MA protocol based on 25 VNTR loci Amplified in four multiplex PCR reactions Amplified in four multiplex PCR reactions Fluorescently labeled PCR amplicons sized using capillary electrophoresis system (CEQ 8000, Beckman Coulter, Fullerton, CA) Fluorescently labeled PCR amplicons sized using capillary electrophoresis system (CEQ 8000, Beckman Coulter, Fullerton, CA) Internal validation at the CDC PulseNet Methods Development and Validation Laboratory started in summer 2004 Internal validation at the CDC PulseNet Methods Development and Validation Laboratory started in summer 2004

16. E. coli O157 strains used in the initial validation 152 isolates analyzed by both MLVA and PFGE using XbaI 152 isolates analyzed by both MLVA and PFGE using XbaI Geographically diverse sporadic isolates with unique XbaI PFGE patterns (UPP collection) Geographically diverse sporadic isolates with unique XbaI PFGE patterns (UPP collection) Outbreak isolates from eight well characterized outbreaks Outbreak isolates from eight well characterized outbreaks Epidemiologically unrelated isolates clustered by PFGE Epidemiologically unrelated isolates clustered by PFGE A subset of 54 isolates were further characterized with BlnI A subset of 54 isolates were further characterized with BlnI

17. Nine VNTR loci included in the final MLVA protocol for E. coli O157 VNTR Alternative name 1 Repeat size (bp) No. of repeats No. of allelesInsideORF MinimumMaximum VNTR-3 Vhec3, TR5 642320Yes VNTR-9 Vhec4, TR1 652017No VNTR-10 Vhec1, TR2 6106839Yes VNTR-17TR3621811Yes VNTR-19TR764107Yes VNTR-25TR461208No VNTR-34 Vhec2, TR6 185106Yes VNTR-36Vhec7731514No VNTR-37631914Yes 1 Vhec loci are form Lindstedt et al. (2003); TR loci are from Noller et al. (2003)

18. MLVA protocol steps 1. Boiled whole cell DNA templates prepared from overnight cultures 2. Nine VNTR sites amplified in three PCR reactions 3. Diluted (1:60) PCR products mixed with sample loading solution and 600 bp DNA size standard 4. PCR products sized using CEQ 8000 capillary electrophoresis system (Beckman Coulter) 5. Fragment list exported to BioNumerics (Applied Maths, Kortijk, Belgium) for analysis

19. Discriminatory power of MLVA compared to PFGE 152 isolates 152 isolates 133 unique MLVA patterns 133 unique MLVA patterns 126 unique XbaI PFGE patterns 126 unique XbaI PFGE patterns A subset of 54 isolates were characterized by PFGE using two enzymes A subset of 54 isolates were characterized by PFGE using two enzymes 35 unique MLVA patterns 35 unique MLVA patterns 39 unique XbaI-BlnI PFGE patterns 39 unique XbaI-BlnI PFGE patterns

20. Clustering of 152 E. coli O157:[H7] isolates by MLVA Cluster I Cluster II SakaiEDL933

21. Clustering of 43 E. coli O157:[H7] isolates by MLVA and by PFGE using combined XbaI-BlnI data MLVA IIMLVA IbMLVA Ia PFGE IIIPFGE I PFGE II

22. GA water park outbreak CT apple cider outbreak CO outbreak Western States outbreak WI restaurant outbreak NY County Fair MI outbreak NJ outbreak Clustering of outbreak isolates and some selected sporadic isolates by MLVA

23. Clusters 0411ml-1c and 0501ml-1c – PFGE pattern combination EXHX01.0086/EXHA26.0576

24. Conclusions from the on-going validation of the E. coli O157 MLVA protocol Overall, MLVA slightly less discriminating than PFGE with two enzymes Overall, MLVA slightly less discriminating than PFGE with two enzymes MLVA can further discriminate some of the most common PFGE patterns MLVA can further discriminate some of the most common PFGE patterns Epidemiological congruence of the MLVA data better than that of PFGE Epidemiological congruence of the MLVA data better than that of PFGE Development of interpretation guidelines may pose a challenge Development of interpretation guidelines may pose a challenge

25. Future plans 2005: 2005: Complete the CDC internal validation of the E. coli O157 MLVA protocol Complete the CDC internal validation of the E. coli O157 MLVA protocol Custom-made 1 kb standard for the locus VNTR-10? Custom-made 1 kb standard for the locus VNTR-10? Reagent evaluation Reagent evaluation Fine-tuning of the BioNumerics scripts Fine-tuning of the BioNumerics scripts Begin collaborative validation of the E. coli O157 MLVA protocol by transferring the protocol to four PulseNet laboratories Begin collaborative validation of the E. coli O157 MLVA protocol by transferring the protocol to four PulseNet laboratories

26. Future plans (cont’d) 2006 2006 Expand the implementation of the protocol to at least four more PulseNet laboratories Expand the implementation of the protocol to at least four more PulseNet laboratories Establish a national database with a pattern naming strategy Establish a national database with a pattern naming strategy Establish interpretation criteria Establish interpretation criteria

27. SNP-based Typing of E. coli O157

28. AAGGTTA ATGGTTA

29. SNPs as genotyping markers Unambiguous data Easy to exchange/compare in database Good potential for automation Amenable to high-throughput platforms Useful for long-term epidemiology/population genetics Alternative for typing highly clonal species, serotypes

30. E. coli O157 genes are highly conserved Mosaic genome ~5.59Mb Genomic diversity by PFGE & MLVA >99.9% homology in orthologous genes MLST didn’t work well for typing O157 Noller et al: 7 housekeeping + 2 membrane protein genes 77 isolates, >18 PFGE types, 2 STs (1 SNP in ompA) Foley et al: 7 virulence + 1 housekeeping genes 92 isolates, 72 PFGE types, 5 STs (2 SNPs in eaeA, 1 in hlyA, 10 in uidA)

31. In silico genome comparison http://www.genome.wisc.edu/ http://genome.gen-info.osaka-u.ac.jp/ http://colibase.bham.ac.uk/ http://snpsfinder.lanl.gov/ Anchor Sakai query EDL933 Most genes are 100% identical ~100 loci bearing SNPs (phageborne, sequencing errors, or paralogous…) Need a better strategy to identify novel SNPs

32. NimbleGen CGR microarray Singh-Gasson et al. 1999. Nat. Biotechnol. 17:974-978 Nuwaysir et al. 2002. Genome Res. 12:1749-1755 Mutation MappingResequencing

33. Selection of genes for CGR Ohnishi et al. 2002. PNAS. 99:17043-17048 Conserved among different E. coli O157 isolates Single-copy in the genome Re-sequencing capacity per slide ~1.2Mb (~1,200 genes) 376 O157-specific genes in 95 “size-conserved” S-loops (including many virulence factors) ~69 housekeeping genes with putative SNPs 754 additional backbone genes randomly-selected throughout the entire genome Large virulence plasmid (pO157)

34. O157 strains for resequencing StrainOriginYearCharacteristics PFGE pattern SakaiJapan1996stx1+, stx2+0373 F5733Georgia1998stx1+, stx2+0224 G5289Washington1994stx2+, Phage type 310238 01-577Virginia2001stx2+, PFGE type 00470047 N0436Colorado2002stx1+1315 N0303New York2001stx1+, stx2+0264 N0587North Carolina2001stx2+0390 F6141Georgia1998stx1+, stx2+0224 F8768Colorado2002stx2+1264 G5101Washington1993stx1+, stx2+, Mug+, Urea+2529 493/89Germany1989stx2+, Sorbitol+, O157:H-2528

35. Total no. of SNPs in test strains = 836 StrainCharacteristics PFGE pattern Total no. of SNPs Strain-specific SNPs Sakaistx1+, stx2+0373-- F5733stx1+, stx2+022400 G5289stx2+, Phage type 31023891 01-577stx2+, PFGE type 00470047160 N0436stx1+1315304 N0303stx1+, stx2+0264456 N0587stx2+039011021 F6141stx1+, stx2+022415018 F8768stx2+126416425 G5101stx1+, stx2+, Mug+, Urea+252935192 493/89stx2+, Sorbitol+, O157:H-2528473197 No. of unique SNPs common in G5101 & 493/89 =138 * Average SNPs between any of two O157:H7 = 65 * No. of informative SNPs to differentiate between any of two O157:H7 = 139

36. Polymorphic genes/regions: 836 SNPs in 503 genes, 65 gene >3 SNPs ECs1934: backbone, putative exonuclease VIII (RecE) prophage CP-933U 22 SNPs ECs1205: Shiga-toxin II subunit A (6 SNPs in 960-bp) ECs1206: Shiga-toxin II subunit B (0 SNPs in 270-bp) ECs2973-2974: Shiga-toxin I (1 SNP in subunit B) Conserved genes/regions: S-loops related to adhesion/invasion LEE (Locus of enterocyte enfacement) Type III secretion system Backbone regions, i.e. between S270-S276

37. Data analysis in progress: Backbone vs. S-loops Transition vs. transversion Synonymous vs. non-synonymous Insertions/deletions Phylogenetic analysis

38. Conclusions PFGE will continue to be an essential subtyping method for PulseNet PFGE will continue to be an essential subtyping method for PulseNet MLVA may provide additional discrimination for E. coli O157:[H7] and some Salmonella serotypes MLVA may provide additional discrimination for E. coli O157:[H7] and some Salmonella serotypes MLVA protocol for E. coli O157 :[H7] will be transferred to selected PulseNet laboratories in 2005 MLVA protocol for E. coli O157 :[H7] will be transferred to selected PulseNet laboratories in 2005 SNP is the subtyping method of the future; SNP may be used in combination with MLVA SNP is the subtyping method of the future; SNP may be used in combination with MLVA Much work needs to be done on new subtyping methods for PulseNet Much work needs to be done on new subtyping methods for PulseNet