1. Construction of an Enriched Microsatellite Library for the Lizard Sceloporus undulates erythrocheilus Wendy Jin, Matthew Rand, Stefano Zweifel Department of Biology, Carleton College; Northfield, MN Introduction Future Work Acknowledgements Microsatellites Figure 1. Red-lipped plateau lizards (Sceloporus undulatus erythrocheilus) As first described by Darwin (1871), sexually dimorphic coloration commonly evolves through sexual selection. In a few species, males exhibit alternate reproductive strategies which are often associated with polymorphic color differences. Adult male red-lipped plateau lizards (Sceloporus undulatus erythrocheilus) found in the foothills of the eastern Rocky Mountains have been observed to develop one of three facial color morphs at sexual maturity: orange, yellow, or white. The majority of males exhibit either the orange or yellow coloration, while only two populations harbor the rarer white morph. These facial colors appear to signal social status, particularly during aggressive interactions among adult males. While the exact mechanisms underlying color development are poorly understood, a few lines of evidence suggest heritable rather than environmental influences. We are constructing genomic libraries for Sceloporus undulates erythrocheilus to identify molecular markers that will allow paternity/maternity identification within a marked breeding population. Ultimately, polymorphic microsatellite DNA will be used to follow the reproductive success of individual males from year-to-year. This information will allow us to estimate the relative fitness of each male morph in a population over time. A microsatellite is a repeated motif of nucleotides, usually two or three bases in length, usually located within noncoding regions of DNA. Often, the number of repeats at microsatellite loci varies between individuals in a population, allowing microsatellites to be used as genetic markers for a variety of applications, such as kinship and population studies. Polymorphism in microsatellite length can be determined by amplifying potential microsatellite regions using Polymerase Chain Reaction (PCR) and sequencing amplified DNA products. We thank L. Wagner for her guidance and unbridled enthusiasm. This project was supported by the Rosenow Fund at Carleton College. Results Figure 2. Schematic representation of the construction of an enriched microsatellite library. 1) Purify genomic DNA from lizard tail tissue. 2) Fragment DNA with the restriction enzyme BfuCI. 3) Ligate both ends of DNA fragments to an adaptor made of oligonucleotides. 4) Perform specific hybridization (microsatellite enrichment) by adding biotinylated oligonucleotide probes that will bind probe-specific repeat regions. Streptavidin-coated magnetic beads irreversibly bind to biotin, allowing for the capture of microsatellite-containing DNA fragments. 5) Amplify DNA fragments using the ligated adaptors as primers for Polymerase Chain Reaction (PCR). 6)Digest adaptors using BfuCI. 7) Ligate genomic DNA into pBluescript KS + II (pBS) vector. 8)Transform genomic library into E. coli cells and color screen in the presence of ampicillin, X-gal, and IPTG. Colonies that grow are ampicillin resistant, reflecting a successful transformation. White colonies represent E. coli with an insert, and blue colonies represent E. coli without an insert. 9) Isolate colonies and sequence DNA of interest. Currently, the Molecular Biology course is creating an additional microsatellite library enriched for (CAG) n and (CA) n repeats for the red-lipped prairie lizard. In order to test microsatellite polymorphism, we will design PCR primers that flank identified microsatellite regions. Using these primers, we will amplify DNA from additional samples of Sceloporous undulates erythrocheilus. Successfully amplified samples will finally be genotyped for microsatellite polymorphism.. 9 of the 20 plasmids that were sequenced contained microsatellite regions. This frequency represents a significant increase from previous non-enriched microsatellite library experiments at Carleton in which only approximately 20 of 30,000 screened plasmids contained microsatellites. See Figure 3 for one of these sequences. AACNGGTACGGGCCCCCCTCGAGGTCGACGGTATCGATAAG CTTGATATCGAATTCCTGCAGCCCGGGGGATCAGAACAAGGA GCCCAGCATCAATCATATCACTGGGTGCCTCATTCTGACCTC AGAGTGAGCAACTTGTGCCAGTGGCAATGGGTGGCACAGCC GCCTGGCATTGGAACAGGAGAAGGTGATTTATTTAAAACTAT TTTAAGGGTTGTATATCTCAGGTTTGGTGCTGAACTGGCTGG AAATCATCTGGTCAGTTTGACTGGAACTGGGGATTGGGCCCT TAATCATTCAGACTGTAGAAATAGGGGGGAAGATGTTTTATA ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC AGCAGCAGCAGCAGCAGCAGCAACATTTATTTTCTACCTGC CTCTCTCCATGGATCCGTTTTGGGGCCTCTGGCATCCCATGG GCAGAAGGAGCAGCCCCAAAACCTGAAGGGCCCCCTCTCTG CATTGAGACAGTTGGGGCAGCCCTTCTGCCACCTTCCACGGA AAGAGGAACACACTCCGCATGCCTGGACTATGGCGCTTGTG GGGTGCCTTCCTTTTTGGGGAGGGGGCTGTGGGANCGGGAG GGCCCCATCCACGCGCGTTCCCTCACGGTGCCCACTGTGTAT CCAGGGATGAACCTTTGGTACTGATCCACTATTCTAGAGCGC CGCCACCGCGGTGGANCTCCANTCCCCCTATAGTGATCGAAT CTACGGCGCTCCTGGGCCGTCGTTTTACACGTCGTGACTGGA AAACCCTGGCGTTACCAACTTATCCNCTTGCAGCAATCCCCT TNNCAGNNGGGGTAANACCAAAAGCCCCACNNTTNCNTTCC AAAANTNCCNACN Figure 3. DNA sequence of genomic DNA enriched in (CAG) n repeats. Designed primers are highlighted in blue. Figure 4. Chromatograph of above sequence. Figure 3. DNA sequence of genomic DNA enriched in (CAG) n repeats.