1. Previously and then some Transcription basics: DNA structure, Parts of a eukaryotic gene, initiation, elongation, termination 1) If the DNA in every cell in your body is the same why don't your adipose (fat) cells secrete epinephrine? 2) If the DNA contains all of the information why doesn't the ribosome just 'read' it? Why make RNA? (stated another way– what are the benefits of having an RNA intermediate in the process of gene expression)

2. Synthesis overview And during/after RNA is made: Processing http://www.youtube.com/watch?v=YjWuVrzvZYA

3. Translation: Converting the blueprint into a working model 36” 72’ Grade P red oak, inlay mahaog Still ‘defining normal’ Are cytosolic and integral membrane proteins transcribed the same way? Are they translated the same way?

4. Three basic steps From nucleotides to amino acids---How? InitiationElongationTermination Fig 4-26 http://www.youtube.com/watch?v=4PKjF7OumYohttp://www.youtube.com/watch?v=4PKjF7OumYo 4:29-6:58

5. Two adaptors used: tRNA and amino acyl tRNA-synthetases *Codons, Anticodons, and Wobble *‘Charging’ of tRNA *Basepairing with a tRNA Fig4-26 *Using Inosine w/ A, U, or C Fig 4-28

6. That Degenerate Genetic code # codons > # tRNAs > # aminoacids How did they figure out the genetic code? Strings of identical nucleotides Nirenberg CCAGAGCAGACUGCUUAGCUUCAUCCCACGAACGGGAG P E Q T A STOP L H P T N G ? Q S R L L S F I P R T G R A D C L A S S H E R E

7. Players? How does the complex know where to start translating? In Bacteria? In eukaryotes? 3’ mRNA 5’ AAAAAAAA Initiation factors IFs Small subunit of ribosome Initiator tRNA Met Once initiation complex forms large subunit of ribosome is recruited

8. Elongation Players? mRNA Aminoacyl- tRNAs Elongation factors Ribosome Requires GTP hydrolysis Results in peptide bond formation Chain grows from N to C P site A site E site

9. Termination Players? mRNA Termination factors Ribosome Fig 4-40 How does it work? Why does the chain end? http://www.brookscole.com/chemistry_d/templates/student_resources/shared_resources/animations/protein_sy nthesis/protein_synthesis.html Skip to ‘Initiation’

10. The Protein What happens to the protein? Folding Sorting What happens to the mRNA, the ribosomes & the tRNA? Reuse Polysomes

11. Translation, Bipolar Disorder, and …… What does this have to do with bipolar disorder? Nobel Prize for Medicine 2000: Dopamine as a neurotransmitter and its role in brain dysfunctions (Dopamine is the catecholamine implicated in bipolar disorder) Biaxial Theory ‘Most simply, manic states are here understood as the clinical expression, at one point in time, of excessive synaptic neurochemical capacity within the primary affective system, and depressive states as the clinical expression of neurotransmitter depletion’ Askland and Parsons (2006)

12. Tale of 2 proteins--a stretched metaphor Neuropeptides synthesized in cytosol sorted/packaged into vesicles for use. (as is dopamine- but not through translation) Protein 1: Many neurotransmitters are amino acids, amino acid derivatives (like dopamine), or short peptides Protein 2: Neurotransmitter receptors are proteins. Synthesized in cytosol, inserted into ER membrane and sent to proper location on plasma membrane Broad Hypothesis: Perhaps Bipolar is a result of problem(s) Getting the transmitters or the receptors to the right place at the right time. (neurochemical part of biaxial theory)

13. Synaptic vesicles What are they? Vesicles are membrane spheres Neurotransmitters are polar How do they get in? How does neurotransmitter packaging occur?