1. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Chapter 3 Fundamentals of Mapping and Sequencing Basic principles and procedures of mapping and DNA sequencing

2. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contents  Genetic mapping  Physical mapping  Chromosome walking  Determining DNA sequences: quick revision  New techniques for mapping and sequencing

3. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Why map before sequencing?  Major problem in large-scale sequencing:  Current technologies can only sequence 600– 800 bases at a time  One solution: make a physical map of overlapping DNA fragments: Top-Down approach  Determine sequence of each fragment  Then assemble to form contiguous sequence

4. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Mapless sequencing: Bottoms up approach  Alternative solution: fragment entire genome  Sequence each fragment  Assemble overlapping sequences to form contiguous sequence  Focus on principles and techniques of mapping and sequencing

5. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Mapping I  Mapping is identifying relationships between genes on chromosomes  Just as a road map shows relationships between towns on highway  Two types of mapping: genetic and physical

6. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Mapping II Genetic mapping  Based on differences in recombination frequency between genetic loci  Physical mapping  Based on distances in base pairs between specific sequences found on the chromosome  Most powerful when genetic and physical mapping are combined

7. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping I  Based on recombination frequencies  The further away two points are on a chromosome, the more recombination there is between them  Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci  Distance between the markers

8. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping II  Genetic mapping requires that a cross be performed between two related organisms  The organism should have phenotypic differences resulting from allele differences at two or more loci  The frequency of recombination is determined by counting the F 2 progeny with each phenotype

9. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example I  Genes on two different chromosomes  Independent assortment during meiosis  No linkage F1F1 9:3:3:1

10. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example II  Genes very close together on same chromosome  Will usually end up together after meiosis  Tightly linked F1F1 1:2:1

11. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example III  Genes on same chromosome, but not very close together  Recombination will occur  Frequency of recombination proportional to distance between genes  Measured in centiMorgans recombinants

12. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic markers  Genetic mapping between positions on chromosomes  Positions can be genes  Responsible for phenotype  Examples: eye color or disease trait  Positions can be physical markers  DNA sequence variation

13. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Physical markers  Physical markers are DNA sequences that vary between two related genomes  Referred to as a DNA polymorphism  Usually not in a gene  Examples  RFLP  SSLP  SNP

14. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 RFLP  Restriction-fragment length polymorphism  Cut genomic DNA from two individuals with restriction enzyme  Run Southern blot  Probe with different pieces of DNA  Sequence difference creates different band pattern GGATCC CCTAGG GTATCC GATAGG GGATCC CCTAGG 200400 GGATCC CCTAGG GCATCC GGTAGG GGATCC CCTAGG 200400 * * 200 400 600 12 ** 2 1

15. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 SSLP/Microsatellite Simple-sequence length polymorphism Most genomes contain repeats of three or four nucleotides Length of repeat varies Use PCR with primers external to the repeat region On gel, see difference in length of amplified fragment ATCCTACGACGACGACGATTGATGCT 12 18 12 2 1 ATCCTACGACGACGACGACGACGATTGATGCT

16. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 SNP  Single-nucleotide polymorphism  One-nucleotide difference in sequence of two organisms  Found by sequencing  Example: Between any two humans, on average one SNP every 1,000 base pairs ATCGATTGCCATGAC ATCGATGGCCATGAC 2 1 SNP

17. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Physical mapping  Determination of physical distance between two points on chromosome  Distance in base pairs  Example: between physical marker and a gene  Need overlapping fragments of DNA  Requires vectors that accommodate large inserts  Examples: cosmids, YACs, and BACs

18. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Large insert vectors  Lambda phage  Insert size: 20–30 kb  Cosmids  Insert size: 35–45 kb  BACs and PACs (bacterial and P1 artificial chromosomes respectively)  Insert size: 100–300 kb  YACs (yeast artificial chromosomes)  Insert size: 200–1,000 kb

19. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pros and cons of large-insert vectors  Lambda phage and cosmids  Inserts stable  But insert size too small for large-scale sequencing projects  YACs  Largest insert size  But difficult to work with

20. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 BACs and PACs  BACs and PACs  Most commonly used vectors for large-scale sequencing  Good compromise between insert size and ease of use  Growth and isolation similar to that for plasmids

21. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contigs  Contigs are groups of overlapping pieces of chromosomal DNA  Make contiguous clones  For sequencing one wants to create “minimum tiling path”  Contig of smallest number of inserts that covers a region of the chromosome genomic DNA contig minimum tiling path

22. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contigs from overlapping restriction fragments  Cut inserts with restriction enzyme  Look for similar pattern of restriction fragments  Known as “fingerprinting”  Line up overlapping fragments  Continue until a contig is built

23. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Restriction mapping applied to large-insert clones  Generates a large number of fragments  Requires high-resolution separation of fragments  Can be done with gel electrophoresis

24. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Analysis of restriction fragments  Computer programs perform automatic fragment-size matching  Possibilities for errors  Fragments of similar size may in fact be different sequences  Repetitive elements give same sizes, but from different chromosomal locations

25. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Gel image processing

26. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 FPC: fingerprint analysis window

27. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Building contigs by probing with end fragments  Isolate DNA from both ends of insert  Label and probe genomic library  Identify hybridizing clones  Repeat with ends of overlapping clones

28. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Chromosome walking  Combines probing with insert ends and restriction mapping  First find hybridizing clones  Then create a restriction map  Identify the clone with the shortest overlap  Make probe from its end  Repeat process probe library probe library

29. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequencing  All large-scale sequencing projects use the Sanger method  Based on action of DNA polymerase  Requires template DNA and primer  Polymerase and nucleotides  Polymerase adds nucleotides according to template  Small amount of nucleotide analog included  Stops synthesis

30. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequencing reaction  Chain-termination method  Uses dideoxy nucleotides  When added in right amount, the chain is terminated  Every time that base appears in template  Need a reaction for each base: A, T, C, and G 3’ ATCGGTGCATAGCTTGT 5’ 5’ TAGCCACGTATCGAACA* 3’ 5’ TAGCCACGTATCGAA* 3’ 5’ TAGCCACGTATCGA* 3’ 5’ TAGCCACGTA* 3’ 5’ TAGCCA* 3’ 5’ TA* 3’ Sequence reaction products Template

31. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence detection  To detect products of sequencing reaction  Include labeled nucleotides  Formerly, radioactive labels used  Now, fluorescent labels used  Use different fluorescent tag for each nucleotide  Can run all four bases in same lane TAGCCACGTATCGA A* TAGCCACGTATC* TAGCCACG* TAGCCACGT*

32. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence separation  Terminated chains need to be separated  Requires one-base-pair resolution  See difference between chain of X and X+1 base pairs  Gel electrophoresis  Very thin gel  High voltage  Works with radioactive or fluorescent labels ATCG – +

33. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Capillary electrophoresis  Newer automated sequencers use very thin capillary tubes  Run all four fluorescently tagged reactions in same capillary  Can have 96 capillaries running at the same time 96–well plate robotic arm and syringe 96 glass capillaries load bar

34. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence reading of radioactively labeled reactions  Radioactively labeled reactions  Gel dried  Placed on X-ray film  Sequence read from bottom up  Each lane is a different base – + C A G T

35. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence reading of fluorescently labeled reactions  Fluorescently labeled reactions scanned by laser as a particular point is passed  Color picked up by detector  Output sent directly to computer

36. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Optical Mapping Single-molecule technique  Individual DNA molecules attached to glass support  Restriction enzymes on glass are activated  When DNA is cut, microscope records length of resulting fragments  Has potential to rapidly generate restriction maps

37. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pyrosequencing I  Based on production of pyrophosphate during sequencing reaction  Each time polymerase adds nucleotide (dNTP) to the growing strand, pyrophosphate (PPi) is released  Amount released equal to number of nucleotides added

38. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pyrosequencing II  To quantitate amount of PPi released:  ATP sulfurylase converts PPi to ATP  ATP used by enzyme luciferase to produce light from the substrate luciferin  The amount of light produced is directly proportional to the amount of ATP, which is proportional to the amount of PPi released

39. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pyrosequencing III  Sequential addition of each dNTP gives sequence  Apyrase enzyme used to degrade dNTPs after reaction completed  Sequence read from amount of light emitted as each dNTP is added Nucleotide sequence Nucleotide added

40. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Membrane sequencing  Single DNA molecules pass through pore in membrane  Each nucleotide has slightly different charge  Charge detected as nucleotides pass through membrane  Many problems need to be worked out before this method can be used for genomic sequencing

41. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Summary I  Basics of mapping  Genetic mapping  Based on recombination frequencies  Physical mapping  Requires overlapping DNA fragments  Can use restriction enzymes  Probing with end fragments  Combination: chromosome walking

42. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Summary II  Basics of sequencing  Chain-termination method  Radioactive or fluorescent labels  Separated by gel or capillary electrophoresis  Read from X-ray film or by laser detector  New technologies  Optical mapping  Pyrosequencing  Membrane sequencing