2. AP Biology From Gene to Protein How Genes Work

3. AP Biology Nucleolus Function  ribosome production build ribosome subunits from rRNA & proteins exit through nuclear pores to cytoplasm & combine to form functional ribosomes small subunit large subunit ribosome rRNA & proteins nucleolus

4. AP Biology 1 gene – 1 enzyme hypothesis Beadle & Tatum  Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments  X-rays break DNA  damage a gene wild type grows on minimal media  sugars + required nutrients allows fungus to synthesize essential amino acids mutants require added amino acids  each type of mutant lacks a certain enzyme needed to produce a certain amino acid  non-functional enzyme from damaged gene

5. AP Biology Wild-type Neurospora Minimal medium Select one of the spores Grow on complete medium Minimal control Nucleic acid Choline PyridoxineRiboflavin Arginine Minimal media supplemented only with… Thiamine Folic acid Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete medium X rays or ultraviolet light asexual spores Beadle & Tatum create mutations positive control negative control experimentals mutation identified amino acid supplements

6. AP Biology One gene / one enzyme hypothesis chromosome gene cluster 1 enzyme E glutamateornithinecitruline argino- succinate arginine enzyme Fenzyme Genzyme H encoded enzyme substrate in biochemical pathway gene cluster 2 gene cluster 3 arg-H arg-G arg-F arg-E Damage to specific gene, mapped to nutritional mutations gene that was damaged

7. AP Biology The “Central Dogma” Flow of genetic information in a cell  How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait DNA gets all the glory, but proteins do all the work!

8. AP Biology RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded lots of RNAs  mRNA, tRNA, rRNA, siRNA… RNADNA transcription

9. AP Biology Transcription from DNA nucleic acid language to RNA nucleic acid language

10. AP Biology Transcription Making mRNA  transcribed DNA strand = template strand  untranscribed DNA strand = coding strand same sequence as RNA  synthesis of complementary RNA strand transcription bubble  enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU 5 3 5 3 3 5 build RNA 5  3

11. AP Biology Transcription in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Psssst… no nucleus!

12. AP Biology Transcription in Prokaryotes Initiation  RNA polymerase binds to promoter sequence on DNA Role of promoter Starting point  where to start reading  start of gene Template strand  which strand to read Direction on DNA  always read DNA 3  5  build RNA 5  3

13. AP Biology Transcription in Prokaryotes Promoter sequences TATAAT RNA polymerase Promoter enzyme subunit bacterial DNA –35 sequence –10 sequence TTGACA RNA polymerase strong vs. weak promoters read DNA 3  5

14. AP Biology Transcription in Prokaryotes Simple proofreading 1 error/10 5 bases make many mRNAs mRNA has short life not worth editing! Elongation  RNA polymerase copies DNA as it unwinds ~20 base pairs at a time  300-500 bases in gene builds RNA 5  3 reads DNA 3  5

15. AP Biology Transcription in Prokaryotes Termination  RNA polymerase stops at termination sequence

16. AP Biology Transcription in Eukaryotes Protein RNA Processing Translation Transcription Psssst… DNA can’t leave nucleus!

17. AP Biology Prokaryote vs. Eukaryote genes Prokaryotes  DNA in cytoplasm  circular chromosome  naked DNA  no introns Eukaryotes  DNA in nucleus  linear chromosomes  DNA wound on histone proteins  introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

18. AP Biology Transcription in Eukaryotes 3 RNA polymerase enzymes  RNA polymerase 1 only transcribes rRNA genes makes ribosomes  RNA polymerase 2 transcribes genes into mRNA  RNA polymerase 3 only transcribes tRNA genes  each has a specific promoter sequence it recognizes

19. AP Biology Transcription in Eukaryotes Initiation complex  transcription factors bind to promoter region upstream of gene suite of proteins which bind to DNA  turn on or off transcription TATA box binding site  recognition site for transcription factors  transcription factors trigger the binding of RNA polymerase to DNA

20. AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P 50-250 A’s Post-transcriptional processing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Primary transcript (pre-mRNA)  eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA)  mRNA splicing = edit out introns  protect mRNA from enzymes in cytoplasm add 5 cap add polyA tail ~10,000 bases ~1,000 bases

21. AP Biology Alteration of Pre-mRNA ends add 5 cap  Modified guanine nucleotide  Protects mRNA from enzymes  Helps ribosome recognize attachment site add polyA tail  About 30-200 adenine nucleotides added  Protects RNA from enzymes in cytoplasm  May facilitate export of mRNA to cytoplasm

22. AP Biology Splicing must be accurate No room for mistakes!  splicing must be exactly accurate  a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

23. AP Biology Splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' No, not smurfs! “snurps” snRNPs  small nuclear RNA  proteins Spliceosome  several snRNPs  recognize splice site sequence cut & paste

24. AP Biology Ribozyme Sidney AltmanThomas Cech YaleU of Colorado RNA as ribozyme  some mRNA can even splice itself  RNA as enzyme

25. AP Biology Translation from nucleic acid language to amino acid language

26. AP Biology Translation in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Translation protein Psssst… no nucleus!

27. AP Biology Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribed  Smaller ribosomes Translation in Prokaryotes

28. AP Biology Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes  time & physical separation between processes takes eukaryote ~1 hour from DNA to protein  RNA processing

29. AP Biology Translation in Eukaryotes

30. AP Biology AUGCGUGUAAAUGCAUGCGCCmRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGGDNA AUGCGUGUAAAUGCAUGCGCCmRNA Met Arg Val Asn Ala Cys Ala protein ? codon

31. AP Biology Cracking the code Crick  determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg & Khorana  determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine (phe) Other tests (AAA, GGG…) supported results

32. AP Biology The code Code for ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid  3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG Why is the wobble good?

33. AP Biology Wobble 1 tRNA can recognize 2-3 different mRNA codons Third base of a codon is known as the "wobble position" Explains why the multiple codons per amino acid differ by the third position 45 types of tRNA  translate 64 codons most versatile tRNA's are those with Inosine (I), a modified base, in the wobble position  I can hydrogen bond with U, C, or A.

34. AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon 53 35 35 UAC Met GCA Arg CAU Val

35. AP Biology Transfer RNA structure “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3 end

36. AP Biology Loading tRNA Aminoacyl tRNA synthetase  Specific enzyme which bonds amino acid to specific tRNA  bond requires energy ATP  AMP  energy stored in tRNA-amino acid bond Unstable = so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

37. Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon Structure  ribosomal RNA (rRNA) & proteins  Made in nucleolus  Assemble when attached to mRNA  2 subunits large small EP A

38. AP Biology Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain E site (exit site)  empty tRNA leaves ribosome from exit site

39. Building a polypeptide Initiation  brings together mRNA, ribosome subunits, initiator tRNA-Met  AUG = start codon Elongation  adding amino acids based on codon sequence  Growing polypeptide = peptide bonds Termination  end codon: UAA, UAG, UGA 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

40. AP Biology Polyribosome A cluster of ribosomes simultaneously translating an mRNA strand

41. AP Biology Protein targeting Signal peptide  address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

42. AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' cap polyA tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

43. AP Biology Got Questions? Can I translate that for you?

44. AP Biology Substitute Slides for Student Print version

45. AP Biology Can you tell the story?

46. AP Biology Extra Slides (used some years & not others)

47. AP Biology Translation Codons  blocks of 3 nucleotides decoded into the sequence of amino acids

48. AP Biology Building Proteins Organelles involved  nucleus  ribosomes  endoplasmic reticulum (ER)  Golgi apparatus  vesicles nucleusribosomeER Golgi apparatus vesicles The Protein Assembly Line

49. AP Biology From nucleus to cytoplasm… Where are the genes?  genes are on chromosomes in nucleus Where are proteins synthesized?  proteins made in cytoplasm by ribosomes How does the information get from DNA in nucleus to cytoplasm?  messenger RNA nucleus

50. AP Biology Alternative splicing Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons Starting to get hard to define a gene!

51. AP Biology Domains Modular architecture of many proteins  exons may represent functional units of protein  easier to mix and match in the production of new proteins?

52. AP Biology So… What is a gene? One gene – one enzyme?  but not all proteins are enzymes  but all proteins are coded by genes One gene – one protein?  but many proteins are composed of several polypeptides  but each polypeptide has its own gene One gene – one polypeptide?  but many genes only code for RNA (tRNA, rRNA…) One gene – one product?  but many genes code for more than one product … So… Where does that leave us?!

53. AP Biology Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene polypeptide 1 polypeptide 2 polypeptide 3 RNA gene It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like.

54. AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA CATCGACCTGCTCGTACATGCTACTAGCTACTG ACTCATGATCCAGATCACTGAAACCCTAGATC GGGTACCTATTACAGTACGATCATCCGATCAGA TCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGAT ACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATC CGATCAGATCATGCTAGTACATCGATCGATACT GCTACTGATCTAGCTCAATCAAACTCTTTTTGC ATCATGATACTAGACTAGCTGACTGATCATGAC TCTGATCCCGTAGATCGGGTACCTATTACAGTA CGATCATCCGATCAGATCATGCTAGTACATCGA TCGATACT human genome 3.2 billion bases

55. AP Biology Any Questions?? What color would a smurf turn if he held his breath?

56. AP Biology 20-30b 3' introns The Transcriptional unit transcriptional unit TACACT DNATATA 5' RNA polymerase 5'3' 5'3' exons enhancer 1000 + b