Download presentation
Presentation is loading. Please wait.
1
Transcription vs. Translation
Making Proteins
2
Bring amino acids to ribosome
Reviewing RNA Section 12-3 RNA can be Messenger RNA Ribosomal RNA Transfer RNA also called which functions to also called which functions to also called which functions to mRNA Carry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome from to to make up DNA Ribosome Ribosomes
3
Transcription RNA polymerase binds to DNA and separates the DNA strand. Then RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA
4
Transcription Section 12-3 RNA polymerase DNA RNA
Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase DNA RNA
5
How does RNA read DNA? What is a codon?
Three nucleotides How does the RNA know where to start? DNA polymerase only binds to promoters Specific codon that signifies the beginning of a sequence (AUG or methionine) How does the RNA know when to stop? Specific codons that signify the end of a protein chain (there are 3 of them)
6
Transcription Video Click Here
7
Transcription Activity
The following is a DNA code. Translate them into RNA and then into a protein chain using page 303 in your textbook: DNA= TAC CGA TTA GCG ATG AGT AGA ACT RNA= AUG GCU AAU CGC UAC UCA UCU UGA Start Alanine Asparagine Arginine Tyrosine Serine Serine Stop
8
Transcription vs. Translation
Making Proteins
9
Bring amino acids to ribosome
Reviewing RNA Section 12-3 RNA can be Messenger RNA Ribosomal RNA Transfer RNA also called which functions to also called which functions to also called which functions to mRNA Carry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome from to to make up DNA Ribosome Ribosomes
10
Reviewing Transcription
Making mRNA from Copying DNA How is it different from DNA Replication? DNA Replication Transcription Copies both strands making 2 new DNA molecules Copies one strand of DNA making 1 mRNA Uses DNA Polymerase Uses RNA polymerase Happens when cell splits Happens all the time
11
Translation Cell uses information from mRNA to produce proteins
tRNA brings amino acids to the mRNA chain Anticodon on tRNA binds to codon on mRNA Amino Acids are bonded to each other in a process called elongation
13
Section 12-3
14
Translation Video Click HERE
15
Activity Transcribe and then Translate the following DNA code into a protein chain. ATTACACCGCATATACTAAC
16
Homework Explain the entire process for creating a protein (transcriptions and translation) Use the following DNA code to help you: TCTACGCAAAGACCTTAGCATATAACACTTAG Use pictures or drawings to illustrate what is happening in each step Use the following vocab words: RNA polymerase, Codon, Anticodon, Elongation, DNA, mRNA, tRNA, amino aicd, protein
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.