Download presentation
Published byRoland Blankenship Modified over 9 years ago
1
Dave Palmer dpalmer@zdap.com
Primer Design Dave Palmer
2
Why Are Primers Important?
Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great. Bad primer design: PCR works terrible.
3
Very-Brief PCR Reminder
PCR is a method to amplify large quantities of a DNA covering a specific sequence.
4
Factors That Affect Priming
Melting / Annealing Temperature Of primers to target Secondary Structure Within target Complementarity Primers to target Primers to each other
5
Factor 1: Melting / Annealing Temperature
aagtcagtcagtactagtgatgta aagtcagtcag PRIMER LENGTH Longer primers stick better = melt at a higher temperature. GC CONTENT More G-C content = more triple bonds = primers stick better = melt at higher temperature. PCR Annealing Temp = Melt T - 5°C Tm = [4(G + C) + 2(A + T)] °C Tm = 58.3°C °C (%G-C) - 500/length
6
Factor 2: Secondary Structure
Primers will have difficulty annealing: if they anneal to regions of secondary structure within the target that have a higher melting point than the primer.
7
Factor 3: Complementarity
PRIMER-PRIMER (BAD) Excessive similarity between primers, especially at the 3’ ends, leads to the formation of “primer dimers” PRIMER-TARGET (GOOD) Ideally should be 100% similar for maximal specificity. Primers don’t HAVE to be perfectly similar to target to work. atcggactatcga gctatacttatggcca atcggactatcga tagcctgatagctatacttatggcca
8
What is a Primer-Dimer An unwanted extension product
Results from primers annealing to themselves, or each other, at 3’ ends Extended primers are no longer available to prime target for PCR atcggactatcga gctatacttatggcca atcggactatcgatatgaataccgga tagcctgatagctatacttatggcca
9
Two Strategies for Primer Design
Pick a primer pair and optimize PCR conditions for it. If an exact sequence site needs to be primed or amplified. If you’re working with someone else’s primers. Optimize the primer design to work in a specific set of PCR conditions. If you’ve got flexibility around the amplified site. Allows more “standardized” PCR conditions. ?
10
Strategy 1 for Primer Design: Fixed Primers, Vary Conditions
With a given primer pair, the Tm can be calculated. Run multiple PCR reactions, each using a different annealing temperature (= Tm - 5). “Bracket” Ta: – 10C, -5C, 0C, +5C, +10C Temp too low: Smearing due to non-specific priming Temp too high: No amplification due to no priming Choose conditions which give the best results.
11
Strategy 2 for Primer Design: Optimizing Primers for Set Conditions
PCR conditions (esp. annealing temp) are kept constant. Select primers for a theoretical Tm. Best to select multiple primers, then experiment to see which combination works best. F1: atcgatcgatcgatcagtcatcg F2: gtactgagctagctgcagctc R1: atgactgagctgctagcttg R2: atgcatgctcgtgactgtg F F2 R1 F1/R1 F2/R1 R2 F1/R2 F2/R2 95C – 65C – 72C
12
Designing Primers Primer Design on the Web
Example: “Primer3” Example gene: GFP5 Green Fluorescent Protein GFP5, Genebank 1 ggatccaagg agatataaca atgagtaaag gagaagaact tttcactgga gttgtcccaa 61 ttcttgttga attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 121 aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 181 ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 241 acccagatca tatgaagcgg cacgacttct tcaagagcgc catgcctgag ggatacgtgc 301 aggagaggac catcttcttc aaggacgacg ggaactacaa gacacgtgct gaagtcaagt 361 ttgagggaga caccctcgtc aacaggatcg agcttaaggg aatcgatttc aaggaggacg 421 gaaacatcct cggccacaag ttggaataca actacaactc ccacaacgta tacatcatgg 481 ccgacaagca aaagaacggc atcaaagcca acttcaagac ccgccacaac atcgaagacg 541 gcggcgtgca actcgctgat cattatcaac aaaatactcc aattggcgat ggccctgtcc 601 ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 661 agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 721 atgaactata caaataagag ctc
13
Designing Primers Primer Design on the Web Using Primer3
Enter sequence Pick Primers
14
Designing Primers Primer3 Advanced Controls Primer Size Primer Tm
Complementarity
15
Designing Primers Primer3 Output Details: Start Length Tm GC Sequence
Where they bind:
16
Designing Primers Primer 3 Output, continued
17
Primer Evaluation Let’s assume we selected the first primer pair (for + rev) Website for online primer evaluation: TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA Enter Sequence
18
Primer Evaluation Website displays potential problems with primer self-annealing More advanced software can examine interactions between primers TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA Graphical Output
19
Primer Evaluation Just for fun, let’s assume we selected a really BAD primer... GGGCCCCTCACCAACCCGTGCCCGGG
20
Live Example Primer Design
Primer Design Workflow: 1. Pick a gene. ie. BRCA1 2. Pull up sequence for the gene. a. b. search Nucleotide Database for brca1 c. scroll through accessions for desired one 3. Copy sequence to text editor. 4. Pull up a primer design website. a. b. copy sequence c. select options and choose Pick Primers 4b. Verify primers find target (optional) a. b. select nucleotide blast c. enter primer sequence, choose blast 4c. Analyse and double-check the primers a. b. enter sequence, view 5. Order oligos. a.
21
End of Primer Design
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.