1. Monday 2/9/15 Monday 2/9/15 Get out your study guides!!! Turn in your Unit 7 Warm-ups (you should have SEVEN)

2. UNIT 6 & 7 REVIEW

3. Which species is the most closely related to the sea lion? seals

4. Which two species share the least characteristics? A. raccoons and weasels B. otters and Felids Otters & Felids

5. Which animals have hair? leopard

6. Which animals have a vertebral column? Lamprey, tuna, salamander, turtle & leopard

7. 7 PP 1o1o 1o1o 2o2o 2o2o 3o3o 2o2o 3o3o 2o2o 2o2o 4o4o 3o3o 3o3o 2o2o 3o3o 3o3o Which organism(s) can be both a 2 nd & 3 rd level consumer? Coyote, Hawk, Roadrunner

8. Which organism would be on the bottom of the energy pyramid? Grass & cactus

9. In the nitrogen cycle, what organisms that live in soil and on roots fix or make usable by plants the greatest amount of nitrogen? Bacteria fix the most nitrogen. Are bacteria biotic or abiotic? Biotic (living)

10. What would happen if decomposers like earthworms or microorganisms were removed from an ecosystem? The cycle will be disrupted and slowed

11. If a bee eats nectar from flowers and pollinates the flowers at the same time, what type of relationship would it be? Mutualism, they both get something good.

12. How is a tick feeding on a dog considered to be parasitic? The tick takes away nutrients from the dog.

13. Write in the percentage of energy at each level in the food chain. 100% Bird Grass Grasshopper Snake 10% 1%.1%

14. What would happen if the bird population increased? The grasshoppers would decrease and the grass and snakes would increase Bird Grass Grasshopper Snake

15. What is the role of the bird? Bird Grass Grasshopper Snake Producer 1 o Consumer 2 o Consumer 3 o Consumer

16. Which level provides the most energy? Grass Grasshopper Raccoon Wolf Producers 1 st Consumer 2 nd Consumer 3 rd Consumer

17. If there are 50 kilocalories of energy at the tertiary consumer level in a habitat, how many kilocalories would be at the producer level? 50 tertiary 500 secondary 5,000 primary 50,000 producer

18. How much energy is passed to the next level? 10% What happens to the other 90%? Used by the organisms at that level & given off as heat

19. How does species diversity change over time as a result of succession? Diversity INCREASES

20. Which taxon is more specific? Family species class genus species

21. What is the difference between primary & secondary succession? Primary succession begins with pioneer species (lichens) & occurs on barren, uninhabited land.

22. Describe the order of how primary succession would occur. Barren land Lichens & mosses appear Grasses & small plants appear Small trees appear

23. What is the benefit of having a classification system? Common understanding of how to classify & name organisms

24. If an organism has genes that improve their ability to survive & reproduce, then what will most likely increase? The frequency of genes in the population

25. Why does a pesticide used to kill insects lose its effectiveness over time? resistant Insects become resistant to the pesticide & the frequency of that allele increase

26. Why is overfishing detrimental to the overgrowth of plant life? Reduces the number of organisms that feed on the producers.

27. If a native species & a non-native species are competitors for resources, why is the non-native species more likely to survive than the native species?. The non-native species doesn’t have any natural predators in the ecosystem

28. In a particular ecosystem, a population of red foxes has increased while the coyote population has decreased. What kind of relationship exists between the foxes & the coyotes? The coyotes are predators of the foxes.

29. Present day whales evolved from ancestors that had four legs. What would the fossils look like to support this theory? The oldest fossils had four limbs & the most recent had flipper-like limbs

30. The carbon cycle includes carbon output to the atmosphere and carbon reservoirs. These reservoirs help to maintain atmospheric carbon. What would happen to cause atmospheric carbon to increase? Destruction of any of the carbon reservoirs

31. True or False: Crocodiles have more traits in common with mammals than they do with birds? False; birds & crocodiles are on the same evolutionary branch

32. What type of organism did the pine cone & leaf come from? Pitch pine

33. According to the table, which 2 organisms are more closely related? Mouse & baleen whale AnimalSequence of Bases in Section of Hoxc8 MouseCAGAAATGCCACTTTTATGGCCCT Baleen whaleCCGAAATGCCTCTTTTAAGGCGCT ChickenAAAAAATGCCGCTTTTACAGCTCT