1. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. LECTURE 5 Gene Mutation (Chapter 16.1-16.2) Slides 1-37 On your own: Slides 38-45 1

2. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic variations –On the positive side, mutations are the foundation for evolutionary change needed for a species to adapt to changes in the environment –On the negative side, new mutations are much more likely to be harmful than beneficial to the individual and often are the cause of diseases Understanding the molecular nature of mutations is a deeply compelling area of research. Since mutations can be quite harmful, organisms have developed ways to repair damaged DNA Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 2

3. 16.1 CONSEQUENCES OF MUTATIONS Mutations can be divided into three main types –1. Chromosome mutations Changes in chromosome structure –2. Genome mutations Changes in chromosome number –3. Gene mutations Relatively small change in DNA structure that affects a single gene –Type 3 will be discussed in this chapter 3

4. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display A point mutation is a change in a single base pair It can involve a base substitution Gene Mutations Change the DNA Sequence 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCGAGATC 3’ 3’ TTGCGCTCTAG 5’ A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine A transversion is a change of a pyrimidine to a purine or vice versa Transitions are more common than transversions 4

5. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Mutations may also involve the addition or deletion of short sequences of DNA Gene Mutations Change the DNA Sequence 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCTC 3’ 3’ TTGCGAG 5’ 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACAGTCGCTAGATC 3’ 3’ TTGTCAGCGATCTAG 5’ Deletion of four base pairs Addition of four base pairs 5

6. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Silent mutations are those base substitutions that do not alter the amino acid sequence of the polypeptide Due to the degeneracy of the genetic code Missense mutations are those base substitutions in which an amino acid change does occur Example: Sickle-cell anemia (Refer to Figure 16.1) If the substituted amino acid has no detectable effect on protein function, the mutation is said to be neutral. This can occur if the new amino acid has similar chemistry to the amino acid it replaced Gene Mutations Can Alter the Coding Sequence Within a Gene 6

7. 10 μm Normal red blood cellsSickled red blood cells 10 μm (a) Micrographs of red blood cells : NH 2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – GLUTAMIC ACID – GLUTAMIC ACID... : NH 2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – VALINE– GLUTAMIC ACID... (b) A comparison of the amino acid sequence between normal  -globin and sickle-cell  -globin NORMAL SICKLE CELL Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. © Phototake/Alamy Figure 16.1 7

8. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Gene Mutations Can Alter the Coding Sequence Within a Gene Nonsense mutations are those base substitutions that change a normal codon to a stop codon Frameshift mutations involve the addition or deletion of a number of nucleotides that is not divisible by three This shifts the reading frame so that translation of the mRNA results in a completely different amino acid sequence downstream of the mutation Table 16.1 describes all of the above mutations 8

9. 9

10. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Mutations in the core promoter can change levels of gene expression Up mutations increase expression. Down mutations decrease expression Other important non-coding mutations are in Table 16.2 Gene Mutations outside of coding sequences can still affect phenotype 10

11. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display In a natural population, the wild-type is the relatively prevalent genotype. Genes with multiple alleles may have two or more wild-types. A forward mutation changes the wild-type genotype into some new variation A reverse mutation changes a mutant allele back to the wild-type It is also termed a reversion Gene Mutations and Their Effects on Genotype and Phenotype 11

12. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Mutations can also be described based on their effects on the wild-type phenotype They are often characterized by their differential ability to survive Deleterious mutations decrease the chances of survival The most extreme are lethal mutations Beneficial mutations enhance the survival or reproductive success of an organism The environment can affect whether a given mutation is deleterious or beneficial Some mutations are conditional They affect the phenotype only under a defined set of conditions An example is a temperature-sensitive mutation 12

13. 13

14. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display A chromosomal rearrangement may affect a gene because the chromosomal breakpoint occurs within the gene A gene may be left intact, but its expression may be altered because of its new location This is termed a position effect There are two common reasons for position effects: 1. Movement to a position next to regulatory sequences Refer to Figure 16.2a 2. Movement to a heterochromatic region Refer to Figure 16.2b AND 16.3 Changes in Chromosome Structure Can Affect Gene Expression 14

15. (a) Position effect due to regulatory sequences (b) Position effect due to translocation to a heterochromatic chromosome Coding sequence Core promoter Regulatory sequence Gene B Coding sequence Core promoter Gene A Inversion Translocation Core promoter for gene A is moved next to regulatory sequence of gene B. Active gene Heterochromatic chromosome (more compacted) Euchromatic chromosome Shortened euchromatic chromosome Gene is now inactive. Translocated heterochromatic chromosome B A B A Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Figure 16.2 Regulatory sequences are often bidirectional 15

16. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Geneticists classify animal cells into two types Germ-line cells Cells that give rise to gametes such as eggs and sperm Somatic cells All other cells Germ-line mutations are those that occur directly in a sperm or egg cell, or in one of their precursor cells Refer to Figure 16.4a Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells Refer to Figure 16.4b AND 16.5 Mutations Can Occur in Germ-Line or Somatic Cells 16

17. Figure 16.4 Therefore, the mutation can be passed on to future generations The size of the patch will depend on the timing of the mutation The earlier the mutation, the larger the patch An individual who has somatic regions that are genotypically different from each other is called a genetic mosaic Therefore, the mutation cannot be passed on to future generations Germ-line mutation Gametes Embryo Mature individual Mutation is found throughout the entire body. Half of the gametes carry the mutation. Somatic mutation Patch of affected area None of the gametes carry the mutation. (a) Germ-line mutation(b) Somatic cell mutation Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 17

18. 18

19. 16.2 OCCURRENCE AND CAUSES OF MUTATION Mutations can occur spontaneously or be induced Spontaneous mutations –Result from abnormalities in cellular/biological processes Errors in DNA replication, for example –Underlying cause originates within the cell Induced mutations –Caused by environmental agents –Agents that are known to alter DNA structure are termed mutagens These can be chemical or physical agents Refer to Table 16.4 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 19

20. 20

21. Are mutations spontaneous occurrences or causally related to environmental conditions? This is a question that biologists have asked themselves for a long time Jean Baptiste Lamarck: Physiological adaptation theory Proposed that physiological events (e.g. use and disuse) determine whether traits are passed along to offspring Charles Darwin: Random mutation theory Proposed that genetic variation occurs by chance Natural selection results in better-adapted organisms Spontaneous Mutations Are Random Events 21

22. Joshua and Ester Lederberg(1950s) devised an ingenious way to test these alterative theories experimentally Studied the resistance of E. coli to infection by bacteriophage T1 ton r (T one resistance) Hypothesis: E. coli cells that survive T1 infection were already resistant to the phage prior to exposure Due to random mutations "Replica plating" Random Mutations Can Give an Organism a Survival Advantage 22

23. Figure 16.7 Replica plating A few ton r colonies were observed at the same location on both plates!!! This indicates that mutations conferring ton r occurred randomly on the primary (nonselective plate) The presence of T1 in the secondary plates simply selected for previously occurring ton r mutants This supports the random mutation theory The Lederbergs' experiment: Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Master plate containing many colonies that were grown in the absence of T1 phage Velvet cloth Petri plate with T1 phage The replica is then gently pressed onto 2 secondary plates that contain T1 phage. A velvet cloth (wrapped over a cylinder) is pressed gently onto the master plate and then lifted. A little bit of each bacterial colony adheres to the velvet cloth, thereby creating a replica of the arrangement of colonies on the master plate. Incubate overnight to allow bacterial growth. Petri plate with T1 phage 23

24. The term mutation rate is the likelihood that a gene will be altered by a new mutation It is commonly expressed as the number of new mutations in a given gene per cell generation It is in the range of 10 -5 to 10 -9 per generation The mutation rate for a given gene is not constant It can be increased by the presence of mutagens Mutation rates vary substantially between species and even within different strains of the same species Mutation Rate 24

25. Within the same individual, some genes mutate at a much higher rate than other genes Some genes are larger than others This provides a greater chance for mutation Some genes have locations within the chromosome that make them more susceptible to mutation These are termed hot spots Note: Hot spots can be also found within a single gene Specific bases or regions that are more likely to be the site of a mutation within a gene Mutation Rates and Frequencies 25

26. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Spontaneous mutations can arise by three types of chemical changes 1. Depurination 2. Deamination 3. Tautomeric shift Causes of Spontaneous Mutations The most common; We will focus here 26

27. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Depurination involves the removal of a purine (guanine or adenine) from the DNA The covalent bond between deoxyribose and a purine base is somewhat unstable It occasionally undergoes a spontaneous reaction with water that releases the base from the sugar This is termed an apurinic site Fortunately, apurinic sites can be repaired However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication Causes of Spontaneous Mutations 27

28. Spontaneous depurination Figure 16.8 Three out of four (A, T and G) are the incorrect nucleotide There’s a 75% chance of a mutation Apurinic site 5′ A G C C T TA C G G C C G C C G G C C G A G T TA C (a) Depurination A G T TA C 5 A G T T A C C X G A G T T A C (b) Replication over an apurinic site Depurination DNA replication X could be A, T, G, or C Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ 3′ 5′ 28

29. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) The term refers to the phenomenon that a sequence of 3 nucleotides can increase from one generation to the next These diseases include Huntington disease (HD) Fragile X syndrome (FRAXA) Refer to Table 16.5 for these and other examples Mutations Due to Trinucleotide Repeats 29

30. 30

31. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Certain regions of the chromosome contain trinucleotide sequences repeated in tandem In normal individuals, these sequences are transmitted from parent to offspring without mutation However, in persons with TNRE disorders, the length of a trinucleotide repeat has increased above a certain critical size Disease symptoms occur In some diseases, it also becomes prone to expansion This phenomenon is shown here with the trinucleotide repeat CAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 n = 18 31

32. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display In some cases, the expansion is within the coding sequence of the gene Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of glutamine This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease In other cases, the expansions are located in noncoding regions of genes Some of these expansions are hypothesized to cause abnormal changes in RNA structure Some produce methylated CpG islands which may silence the gene 32

33. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display There are two particularly unusual features that some TNRE disorders have in common 1. The severity of the disease tends to worsen in future generations This phenomenon is called anticipation 2. Anticipation usually depends on whether the disease is inherited from the father or mother In Huntington disease, the TNRE is more likely to occur if inherited from the father In myotonic muscular dystrophy, the TNRE is more likely to occur if inherited from the mother This suggests that TNRE can occur more frequently during oogenesis or spermatogenesis, depending on the gene involved. 33

34. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display The “DNA” cause of TNRE is not fully understood TNREs contain at least one C and one G This allows formation of a hairpin During DNA replication, a hairpin can lead to an increase or decrease in the length of the DNA Polymerase can slip off DNA Hairpin forms and pulls strand back DNA polymerase hops back on Begins synthesis from new location See Figure 16.12 for details These changes can occur during gamete formation offspring will have very different numbers of repeats Can also increase repeats in somatic cells This can increase severity of the disease with age 34

35. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Mechanisms of trinucleotide repeat expansion or deletion Figure 16.12b and c One DNA template strand prior to DNA replication TNRE (b) Mechanism of trinucleotide repeat expansion(c) Mechanism of trinucleotide repeat deletion DNA replication begins and goes just past the TNRE. Hairpin forms in template strand prior to DNA replication. DNA replication occurs and DNA polymerase slips over the hairpin. DNA repair occurs. DNA polymerase slips off the template strand and a hairpin forms. DNA polymerase resumes DNA replication. DNA repair occurs. OR DNA polymerase TNRE is the same length. TNRE is longer. TNRE is shorter. 35

36. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display An enormous array of agents can act as mutagens that permanently alter the structure of DNA The public is concerned about mutagens for two main reasons: 1. Mutagens are often involved in the development of human cancers 2. Mutagens can cause gene mutations that may have harmful effects in future generations Mutagenic agents are usually classified as chemical or physical mutagens Refer to Table 16.6 Types of Mutagens 36

37. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 37

38. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Chemical mutagens come into three main types 1. Base modifiers 2. Intercalating agents 3. Base analogues Mutagens Alter DNA Structure in Different Ways 38

39. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Base modifiers covalently modify the structure of a nucleotide For example, nitrous acid, replaces amino groups with keto groups (–NH 2 to =O) This can change cytosine to uracil and adenine to hypoxanthine These modified bases do not pair with the appropriate nucleotides in the daughter strand during DNA replication Refer to Figure 16.15 Some chemical mutagens disrupt the appropriate pairing between nucleotides by alkylating bases within the DNA Examples: Nitrogen mustards and ethyl methanesulfonate (EMS) 39

40. Uracil HNO 2 Adenine Cytosine H H Sugar O O H N H H N H H Template strandAfter replication Hypoxanthine H N H H O O H H Cytosine Sugar NH 2 O H H Adenine H N H NH 2 Sugar N N N N N N N N N N N N N N N N Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Mispairing of modified bases Figure 16.15 These mispairings create mutations in the newly replicated strand 40

41. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Intercalating agents contain flat planar structures that intercalate themselves into the double helix This distorts the helical structure When DNA containing these mutagens is replicated, the daughter strands may contain single-nucleotide additions and/or deletions resulting in frameshifts Examples: Acridine dyes Proflavin 41

42. N 5-bromouracil (enol form) Guanine Sugar O Br H O O H H H H N N N N N N 5-bromouracil (keto form) Adenine Sugar H H H O ON Br H H N N N N N N Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Base analogues become incorporated into daughter strands during DNA replication For example, 5-bromouracil is a thymine analogue It can be incorporated into DNA instead of thymine Figure 16.16 Normal pairing This tautomeric shift occurs at a relatively high rate Mispairing Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. (a) Base pairing of 5BU with adenine or guanine 42

43. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Figure 16.16 In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair (b) How 5BU causes a mutation in a base pair during DNA replication 5′3′ 5′ A5BU DNA replication G G 5′3′ 5′ 3′ 5′ 5BU DNA replication A 5′3′ 5′ 3′ 5′ AT C Gor Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 43

44. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Physical mutagens come into two main types 1. Ionizing radiation 2. Nonionizing radiation Ionizing radiation Includes X-rays and gamma rays Has short wavelength and high energy Can penetrate deeply into biological molecules Creates chemically reactive molecules termed free radicals Can cause Base deletions Oxidized bases Single nicks in DNA strands Cross-linking Chromosomal breaks 44

45. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Nonionizing radiation Includes UV light Has less energy Cannot penetrate deeply into biological molecules Causes the formation of cross-linked thymine dimers Thymine dimers may cause mutations when that DNA strand is replicated Figure 16.17 Ultraviolet light Thymine dimer Thymine H H H O H H O CH 3 CH 2 H H H O H H O CH 3 CH 2 – – H H H O H H O CH 3 CH 2 H H H O H H O CH 3 CH 2 – – Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. HH O OO O P N N HH O OOP N N O O HH O OOP N N HH O OOP N N O O O O O 45

46. 46

47. Animations 47

48. 48 Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.