1. DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

2. DNA Technology Meet Dolly

3. Biotechnology The manipulation of organisms or use of living things as technology i.e. genetic engineering, manipulating genes for practical purposes

4. Studying One Gene If we want to study a particular gene in depth, it is cumbersome to use the entire DNA molecule Much easier if we can make multiple copies of that one gene to focus on

5. Gene Cloning We will first look at the overview of cloning a particular gene, then go into it in detail The goal is to create multiple copies of a single segment of DNA

6. Step 1A Isolate a plasmid from a bacterial cell

7. Step 1B Isolate the DNA we wish to clone

8. Step 2 Insert gene into plasmid Recombinant DNA

9. Step 3 Reinsert Plasmid into Bacteria Recombinant Bacterium

10. Step 4 Plasmids replicate independently, reproducing the gene of interest

11. Step 5 / Step 6 Identify the bacterial plasmids that did in fact clone the gene Use the gene!  Can use copies of the gene itself  Can use the protein products of the gene

12. Why Is This Useful? We can insert genes into other organisms  i.e. in agriculture we can introduce pest- resistance to crops  Alter bacteria to accomplish a task Create proteins for medicines and other uses  Create Human Growth Hormone to treat short kids

13. Restriction Enzymes Cut DNA at specific places (recognize target sequences) Used to combat foreign DNA in nature Create restriction fragments Creates the same fragments every time

14. Sticky Ends Doesn't cut at the same spot on both strands Leaves single stranded edges called sticky ends These two ends can be resealed by DNA ligase Or new DNA can be inserted between

15. Recombinant DNA using Restriction Enzymes

16. DNA What is a restriction enzyme? What are sticky ends? What is a plasmid? What are some of the uses of genetic engineering?

17. A More Detailed Look at Cloning We use a plasmid containing 2 useful genes  1 – ampicillin resistance  2 – lacz gene Called a cloning Vector Easy to insert in bacteria

18. Restriction Enzyme Targets lacz Gene A restriction enzyme recognizes and cuts a segment of the lacz gene Also cuts DNA containing gene of interest into small fragments

19. Mix Plasmids with Our DNA Sticky ends of plasmid can base pair with sticky ends of DNA Also end up with plasmid-plasmid combos and DNA- DNA combos etc. Seal Plasmid and DNA using DNA ligase

20. Some Plasmids take in the DNA, some Don't DNA is inserted in the middle of the lacz gene if DNA is taken by plasmid Amp gene is intact either way

21. Introduction of Plasmids to Bacterial Cells Recall transformation, bacteria will take up plasmids The bacteria do not have the lacz gene Some bacteria take in plasmids with our DNA Some take in unaffected plasmids

22. Plate the Bacteria We place the bacteria on a plate containing ampicillin and X-gal Only bacteria containing the plasmid can grow (the ampicillin resistance allows their survival) Bacterial Colonies

23. What Is X-Gal? X-gal reacts with galactosidase to create a blue product The product of the lacz gene breaks down galactosidase If the lacz gene is intact – no blue If there is foreign DNA then lacz gene is interrupted and bacteria are blue White Blue

24. Checking our Agar Plate Blue colonies have taken in foreign DNA in their plasmids White colonies have the plasmid – but no foreign DNA is in the plasmid and the lacz gene is intact

25. Isolate Our Gene of Interest The foreign DNA may not have been the gene we care about! We must use nucleic acid probe (a short segment of complementary DNA) to find the gene of interest Attach fluorescent protein to probe

26. Making the Bacteria Express the Gene We can express the gene in the bacteria, but sometimes we need to insert a promoter as well Called an expression vector The promoter tells the prokaryotic RNA polymerase to transcribe the gene

27. cDNA Introns are a pain for prokaryotes Sometimes it's necessary to make DNA without the introns first Use reverse transcriptase to make cDNA from mRNA

28. Genomic Library vs. cDNA library Collection of all of the segments of the DNA that is separated by restriction fragments The library will have multiple copies of each gene Some genes are split between two segments cDNA library contains only the segments that code for a gene In fact only codes for genes transcribed – useful for studying genes expressed in brain cells for example

29. Polymerase Chain Reaction (PCR) Allows us to quickly make many copies of a segment of DNA Very specific, due to use of specific primers that recognize each gene Need only small amount of DNA to replicate

30. PCR Heat the DNA to separate the strands Cool strands and allow DNA primers to bind to DNA DNA polymerase synthesizes new strand Repeat

31. Why is PCR So Amazing? From a small amount of DNA we can make millions of copies Important in solving crimes with DNA, determining paternity etc. Useful for a lot of other biotech processes

32. Gel Electrophoresis Separates DNA, Proteins etc. based on charge and size For DNA, all molecules have the same charges, so separates DNA by length of strand

33. Restriction Fragment Analysis Cut pieces of DNA with restriction enzymes The same DNA with the same enzymes will produce the same fragments every time Show up as bands on gel electrophoresis

34. Southern Blotting The full genome has too many genes to use simple gel electrophoresis (get too many bands) But we can use Southern Blotting to identify only the genes we care about

35. Southern Blotting We add radioactively labelled DNA to our gel electrophoresis We can figure out A) if the DNA segment we are interested in is present and B) What size fragment the segment is located on C) How many times the gene is present

37. Restriction Length Polymorphisms (RFLPs) Recall that human's have DNA that is 99.9% similar So how can we compare DNA? By identifying locations in the genome where people often differ If two people differ in a nucleotide that is part of a restriction site, then only one of the people will have their DNA cut by that restriction enzyme

38. RFLPs

39. Finding Genes in Genomes In situ hybridization Use a radioactive probe that can base pair with the gene i.e. we can see if a gene from a mouse is present in humans

40. The Human Genome Project Working version of genome worked out in 2000 “Final Draft” in 2003 Not a single individual – there are many places where nucleotides differ Available on the Internet

41. Genetic Linkage Mapping As discussed earlier, we can figure out the order of genes by the frequency of recombination Genes that are further apart are more likely to be separated during crossing over

42. Getting the Whole Genome Cut the genome into tons of little pieces These pieces are identifiable restriction fragments Then order fragments by how they overlap Must first clone DNA so we have copies

43. Chromosome Walking Each segment overlaps, so we can use the end of one segment to probe for the next segment

44. DNA Sequencing (The Basics) We take a strand of DNA and make copies of it The DNA is added to a solution containing everything necessary for DNA replication  Primer, DNA Polymerase, A, T, G and C nucleotides One more ingredient in each batch

45. Dideoxy Nucleotides! Special nucleotides that are missing another OH group ddA nucleotides are added to the DNA If a dd nucleotide is added DNA replication ends No phosphodiester bond can be made Each dd nucleotide is labelled with a fluorescent color

46. Synthesize New DNA The DNA is replicated, BUT replication ends as soon as a dd nucleotide is added We end up with a bunch of different length strands, each labelled by the dd nucleotide on the end

47. DNA Segments Are Separated By Size DNA is run through a machine – smaller segments get through faster A computer reads the color at the end Tells us the order of the nucleotides

48. Much Faster than the Sanger Method This revolutionized the Human Genome Project Sanger method – have 4 batches, introduce 1 dd nucleotide to each batch Use gel electrophoresis 4 separate times to determine the length of the strands ending in A, C, G and T

49. We Can Use cDNA to Identify Which Genes Are Expressed Separate genes (by gene cloning and hybridization) Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA

50. Microassay

51. Practical Applications Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!

52. Identifying Diseases Using PCR we can identify a small amount of a virus in a blood sample Can examine a person's genes to look for diseases i.e. Huntington's disease

53. Gene Therapy Correct genetic disorders by changing genes or inserting genes Can we change a person's genes using retroviruses? Ethical dilemma?

54. Pharmaceuticals Make hormones and proteins using bacteria Make vaccines by altering viruses Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?

55. Forensics We can match up DNA found at a crime scene with suspect's DNA Used both to help prove guilt and innocence! Ethical dilemma – should we store DNA of convicted criminals?

56. Agricultural Uses Bovine Growth Hormone to raise milk production Can speed up growth of animals Easier to manipulate genes in plants Can introduce pest resistance, or change nutrition

57. Ti Plasmids in Plants Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant

59. Gene Cloning Restriction Enzyme Plasmid

60. Restriction Enzyme Cuts Plasmid Sticky Ends

61. Same Restriction Enzyme Cuts DNA

62. Mix Plasmid and DNA

63. Make Bacteria Take Up Plasmid

64. Place Bacteria on Agar Plate

65. Bacteria with No Plasmids Are Killed By Ampicillin ampicillin

66. Bacteria with DNA Turns Blue Our DNA

67. Bacteria and Plasmids Replicate

68. DNA Libraries

69. Genomic (all DNA) cDNA (DNA expressed) Then we make copies!

70. Isolate Cells and Collect mRNA Cells from Brain Tissue RNA Polymerase pre-mRNA Spliceosome mRNA

71. Make cDNA out of RNA mRNA Reverse Transcriptase DNA DNA Polymerase cDNA

72. DNA Libraries Genomic (all DNA) cDNA (DNA expressed)

73. Restriction Fragment Length Polymorphism AAAATTTTAAAATTTTAAAATTTT TTTTAAAATTTTAAAATTTTAAAA AAAATTTTAAAGTTTTAAAATTTT TTTTAAAATT TCAAAATTTTAAAA We find the one spot in the sequence where human's are known to differ. We can then find a restriction enzyme that cuts around that spot

74. If We Then Place the DNA in Gel Electrophoresis, We Can Tell the DNA Apart

75. Southern Blotting DNA ADNA B DNA C Red is our gene of interest. We can check if any of the 3 individuals have it and how many times. If we have a sample containing the gene 3 times, we can figure out which person it belongs to

76. Chop up DNA with Restriction Enzyme DNA ADNA B DNA C

77. Use Gel Electrophoresis to Separate Fragments

78. Use X-Ray to View Only the Gene of Interest Compare that to our sample DNA to confirm a match!

79. Chromosome Walking ACGTTGCAT TGCAACGTA Use GCAT as a probe

80. Chromosome Walking ACGTTGCAT TGCAACGTA GCATACGTCGATTG CGTATGCAGCTAAC Use ATTG as probe GATTGCCTGC CTAACCGACG

81. We Can Use cDNA to Identify Which Genes Are Expressed Separate genes (by gene cloning and hybridization) Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA

82. Microassay Fluorescent labelled cDNA from a salivary gland

83. Practical Applications Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!

84. Identifying Diseases Using PCR we can identify a small amount of a virus in a blood sample Can examine a person's genes to look for diseases i.e. Huntington's disease

85. Gene Therapy Correct genetic disorders by changing genes or inserting genes Can we change a person's genes using retroviruses? Ethical dilemma?

86. Pharmaceuticals Make hormones and proteins using bacteria Make vaccines by altering viruses Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?

87. Forensics We can match up DNA found at a crime scene with suspect's DNA Used both to help prove guilt and innocence! Ethical dilemma – should we store DNA of convicted criminals?

88. Agricultural Uses Bovine Growth Hormone to raise milk production Can speed up growth of animals Easier to manipulate genes in plants Can introduce pest resistance, or change nutrition

89. Ti Plasmids in Plants Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant

90. DNA How can we separate bacteria that took up the plasmid from those that did not? What important gene does the plasmid contain? How can we separate bacteria that have our DNA in them from those that do not What gene gets interrupted when foreign DNA is inserted? What is Gel Electrophoresis?