1. MOLECULAR GENETICS CLASS SESSIONS: 1. DNA, Genes, Chromatin 2. DNA Replication, Mutation, Repair 3. RNA Structure and Transcription 4. Eukaryotic Transcriptional Regulation 5. CLASS DISCUSSION – GENETIC DISEASES 6. RNA Processing 7. Protein Synthesis and the Genetic Code 8. Protein Synthesis and Protein Processing 9. CLASS DISCUSSION – GENETIC DISEASES 10. DNA Cloning and Isolating Genes

2. THE FLOW OF GENETIC INFORMATION DNARNAPROTEIN DNA 1 23 1. REPLICATION(DNA SYNTHESIS) 2. TRANSCRIPTION(RNA SYNTHESIS) 3. TRANSLATION(PROTEIN SYNTHESIS)

3. DNA Structure and Chemistry a). Evidence that DNA is the genetic information i). DNA transformation – know this term ii). Transgenic experiments – know this process iii). Mutation alters phenotype – be able to define genotype and phenotype b). Structure of DNA i). Structure of the bases, nucleosides, and nucleotides ii). Structure of the DNA double helix iii). Complementarity of the DNA strands c). Chemistry of DNA i). Forces contributing to the stability of the double helix ii). Denaturation of DNA

4. Thymine (T) Guanine (G)Cytosine (C) Adenine (A) Structures of the bases PurinesPyrimidines 5-Methylcytosine (5mC)

5. [structure of deoxyadenosine] Nucleoside Nucleotide

6. Nomenclature Purines adenineadenosine guanineguanosine hypoxanthineinosine Pyrimidines thyminethymidine cytosinecytidine +ribose uraciluridine Nucleoside Nucleotide Base +deoxyribose +phosphate

7. polynucleotide chain 3’,5’-phosphodiester bond ii). Structure of the DNA double helix Structure of the DNA polynucleotide chain 5’ 3’

8. A-T base pair G-C base pair Chargaff’s rule: The content of A equals the content of T, and the content of G equals the content of C in double-stranded DNA from any species Hydrogen bonding of the bases

9. Double-stranded DNA Major groove Minor groove 5’3’ 5’3’ 5’ “B” DNA

10. Chemistry of DNA Forces affecting the stability of the DNA double helix hydrophobic interactions - stabilize - hydrophobic inside and hydrophilic outside stacking interactions - stabilize - relatively weak but additive van der Waals forces hydrogen bonding - stabilize - relatively weak but additive and facilitates stacking electrostatic interactions - destabilize - contributed primarily by the (negative) phosphates - affect intrastrand and interstrand interactions - repulsion can be neutralized with positive charges (e.g., positively charged Na + ions or proteins)

11. Stacking interactions Charge repulsion

12. Model of double-stranded DNA showing three base pairs

13. Denaturation of DNA Double-stranded DNA A-T rich regions denature first Cooperative unwinding of the DNA strands Extremes in pH or high temperature Strand separation and formation of single-stranded random coils

14. Electron micrograph of partially melted DNA A-T rich regions melt first, followed by G-C rich regions Double-stranded, G-C rich DNA has not yet melted A-T rich region of DNA has melted into a single-stranded bubble

15. Hyperchromicity The absorbance at 260 nm of a DNA solution increases when the double helix is melted into single strands. 260 Absorbance Absorbance maximum for single-stranded DNA Absorbance maximum for double-stranded DNA 220300

16. 100 50 0 705090 Temperature o C Percent hyperchromicity DNA melting curve T m is the temperature at the midpoint of the transition

17. Average base composition (G-C content) can be determined from the melting temperature of DNA 50 706080 Temperature o C T m is dependent on the G-C content of the DNA Percent hyperchromicity E. coli DNA is 50% G-C

18. Genomic DNA, Genes, Chromatin a). Complexity of chromosomal DNA i). DNA reassociation ii). Repetitive DNA and Alu sequences iii). Genome size and complexity of genomic DNA b). Gene structure i). Introns and exons ii). Properties of the human genome iii). Mutations caused by Alu sequences c). Chromosome structure - packaging of genomic DNA i). Nucleosomes ii). Histones iii). Nucleofilament structure iv). Telomeres, aging, and cancer

19. DNA reassociation (renaturation) Double-stranded DNA Denatured, single-stranded DNA Slower, rate-limiting, second-order process of finding complementary sequences to nucleate base-pairing k2k2 Faster, zippering reaction to form long molecules of double- stranded DNA

20. C o t 1/2 DNA reassociation kinetics for human genomic DNA C o t 1/2 = 1 / k 2 k 2 = second-order rate constant C o = DNA concentration (initial) t 1/2 = time for half reaction of each component or fraction 50 100 0 % DNA reassociated I I I I I I I I I log C o t fast (repeated) intermediate (repeated) slow (single-copy) Kinetic fractions: fast intermediate slow C o t 1/2

21. high k 2 10 6 copies per genome of a “low complexity” sequence of e.g. 300 base pairs 1 copy per genome of a “high complexity” sequence of e.g. 300 x 10 6 base pairs low k 2

22. Type of DNA % of Genome Features Single-copy (unique)~75% Includes most genes 1 Repetitive Interspersed~15% Interspersed throughout genome between and within genes; includes Alu sequences 2 and VNTRs or mini (micro) satellites Satellite (tandem)~10% Highly repeated, low complexity sequences usually located in centromeres and telomeres 2 Alu sequences are about 300 bp in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes in introns or nontranslated regions. 1 Some genes are repeated a few times to thousands-fold and thus would be in the repetitive DNA fraction 50 100 0 I I I I I I I I I fast ~10% intermediate ~15% slow (single-copy) ~75%

23. Classes of repetitive DNA Interspersed (dispersed) repeats (e.g., Alu sequences) TTAGGGTTAGGGTTAGGGTTAGGG Tandem repeats (e.g., microsatellites) GCTGAGG

24. viruses plasmids bacteria fungi plants algae insects mollusks reptiles birds mammals Genome sizes in nucleotide pairs (base-pairs) 10 4 10 8 10 5 10 6 10 7 10 1110 10 9 The size of the human genome is ~ 3 X 10 9 bp; almost all of its complexity is in single-copy DNA. The human genome is thought to contain ~30,000 to 40,000 genes. bony fish amphibians

25. 5’3’ promoter region exons (filled and unfilled boxed regions) introns (between exons) transcribed region translated region mRNA structure +1 Gene structure

26. The (exon-intron-exon) n structure of various genes  -globin HGPRT (HPRT) total = 1,660 bp; exons = 990 bp histone factor VIII total = 400 bp; exon = 400 bp total = 42,830 bp; exons = 1263 bp total = ~186,000 bp; exons = ~9,000 bp

27. Properties of the human genome Nuclear genome the haploid human genome has ~3 X 10 9 bp of DNA single-copy DNA comprises ~75% of the human genome the human genome contains ~30,000 to 40,000 genes most genes are single-copy in the haploid genome genes are composed of from 1 to >75 exons genes vary in length from 2,300,000 bp Alu sequences are present throughout the genome Mitochondrial genome circular genome of ~17,000 bp contains <40 genes

28. Familial hypercholesterolemia autosomal dominant LDL receptor deficiency Alu sequences can be “mutagenic” From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.

29. LDL receptor gene Alu repeats present within introns Alu repeats in exons 4 4 4 5 5 56 6 6 Alu X 4 6 unequal crossing over one product has a deleted exon 5 (the other product is not shown)

30. Chromatin structure EM of chromatin shows presence of nucleosomes as “beads on a string”

31. Nucleosome structure Nucleosome core (left) 146 bp DNA; 1 3/4 turns of DNA DNA is negatively supercoiled two each: H2A, H2B, H3, H4 (histone octomer) Nucleosome (right) ~200 bp DNA; 2 turns of DNA plus spacer also includes H1 histone

34. Histones (H1, H2A, H2B, H3, H4) small proteins arginine or lysine rich: positively charged interact with negatively charged DNA can be extensively modified - modifications in general make them less positively charged Phosphorylation Poly(ADP) ribosylation Methylation Acetylation Hypoacetylation by histone deacetylase (facilitated by Rb) “tight” nucleosomes assoc with transcriptional repression Hyperacetylation by histone acetylase (facilitated by TFs) “loose” nucleosomes assoc with transcriptional activation

35. Nucleofilament structure

36. Condensation and decondensation of a chromosome in the cell cycle

37. Telomeres and aging Metaphase chromosome centromere telomere telomere structure young senescent Telomeres are protective “caps” on chromosome ends consisting of short 5-8 bp tandemly repeated GC-rich DNA sequences, that prevent chromosomes from fusing and causing karyotypic rearrangements. (TTAGGG) many (TTAGGG) few telomerase (an enzyme) is required to maintain telomere length in germline cells most differentiated somatic cells have decreased levels of telomerase and therefore their chromosomes shorten with each cell division 12 kb

38. Class Assignment (for discussion on Sept 9 th ) Botchkina GI, et al. “Noninvasive detection of prostate cancer by quantitative analysis of telomerase activity.” Clin Cancer Res. May 1;11(9):3243-3249, 2005 PDF of article is accessible on the website