1. EoC Review Game

2. Unit 1Unit 2Unit 3 Unit 4 Unit 5Unit 6 100 200 300 400 500

3. Unit 1 - 100 If someone was interested in a career with responsibility to determine the cause of death, what careers should he or she consider and investigate?

4. Unit 1 - 200 What is the structure of the body starting with the smallest unit and moving to the largest. (hint: Cell  ______  ________  ________)

5. Unit 1 – 300 Name at least 2 organs from and describe the function of the Respiratory System A system of organs, functioning in the process of gas exchange between the body and the environment, consisting especially of the nose, nasal passages, nasopharynx, larynx, trachea, bronchi, and lungs.

6. Unit 1 - 400 Name at least 2 organs from and describe the function of the Digestive System The group of organs that break down foods into chemical components that the body can absorb and use for energy, and for building and repairing cells and tissues.

7. Unit 1 - 500 Name at least 3 organs from and describe the function of the Cardiovascular System The transport system of the body responsible for carrying oxygen and nutrients to the body and carrying away carbon dioxide and other wastes; composed of the heart, blood vessels, and blood.

8. Unit 2 - 100 What is a pump? A device that raises, transfers, delivers, or compresses fluids or gases especially by suction or pressure or both.

9. Unit 2 - 200 Name the structure at # 2 Superior Vena Cava

10. Unit 2 - 300 What are the four major components of blood and what do they do? Plasma – liquid of blood Platelets – clotting White blood cells – immune system Red blood cells – carry oxygen

11. Unit 2 - 400 What is happening during the “T” wave? Relaxation of the ventricles

12. Unit 2 - 500 Fill in the blanks: Body – Vena Cava – Right Atrium– Tricuspid Valve – Right Ventricle– Pulmonary artery – Lungs – Pulmonary vein – Left atrium – Mitral/Bicuspid– Left ventricle – Aortic semilunar valve – Aorta – Body

13. Unit 3 - 100 Where is insulin made and what is its function? Pancreas; Function: regulate blood sugar(regulate amount of sugar entering cell)

14. Unit 3 - 200 This picture shows the process of ________. hydrolysis

15. Unit 3 – 300 Name the two types of enzymes we learned about in this class. Tell me which on is represented in the picture below. Lock and Key model Induced fit model Picture shows a catabolic lock and key

16. Unit 3 - 400 What are the monomers of the 4 different types of macromolecules? Proteins –Amino Acids Nucleic acids – Nucleotides Carbohydrates – Glucose Lipids – Glycerol and Fatty acid chains

17. Unit 3 - 500 Label the insulin/glucose model. Use the following labels: insulin, glucose, cell membrane, receptor molecule, glut4, mitochondrion, energy

18. Unit 4 - 100 How many individuals have sickle cell disease? 3

19. Unit 4 - 200 What is one symptom of sickle cell disease? What is one complication of sickle cell disease? Symptoms – low oxygen, pain in muscles Complications – heart damage

20. Unit 4 - 300 Who is Henrietta Lacks and describe how her cells are related to the idea of HIPAA. Source of the HeLa cell line. The use of her cells without her permission and tying her name to the cells

21. Unit 4 - 400 If generation IV individual 3 married someone without sickle cell disease or sickle cell trait, what is the probability that their child would have sickle cell disease? 0%

22. Unit 4 - 500 What is the third amino acid in the chain made by the DNA above? CACGTGGACTGAGGACTCTTCAGAG Leucine

23. Unit 5 - 100 What is the difference between saturated and unsaturated fats? Saturated – solid at room temperature, no double bonds in fatty acid chains Unsaturated – liquid at room temperature, at least one double bond in fatty acid chains

24. Unit 5 - 200 Describe the health risks associated with elevated levels of LDL that have earned it the nickname of “bad cholesterol.” Low density lipoprotein ; travels slowly/builds up in blood stream; carries more cholesterol than HDL

25. Unit 5 - 300 Which patient is: – Homozygous recessive? #3 – Homozygous dominant? #2 – Heterozygous? #1 DNA Markers Normal Control +FH Control Patient #1 Patient #2 Patient #3

26. Unit 5 – 400 Based on the molecular structures below, label each of the following as saturated, monounsaturated, or polyunsaturated Palmitic acid = – saturated Stearic acid = – saturated Oleic acid = – monounsaturated Linoleic acid = – polyunsaturated

27. Unit 5 - 500 Explain the process and importance of Polymerase Chain Reaction (PCR) when dealing with small amounts of DNA Process: use restriction enzymes to find the specific piece of DNA you want to copy, replicate the DNA Importance: Amplify DNA so that we can use it in gel electrophoresis

28. Unit 6 - 100 What are 3 differences between Viruses and Bacteria? Virus: not alive unless it’s in a host, cannot replicate on its own Bacteria: replicates by itself, prokaryotic

29. Unit 6 – 200 How is a Gram + cell different than a Gram – cell? + = thick cell wall - = thin cell wall

30. Unit 6 - 300 Describe difference between broad spectrum and limited spectrum antibiotics Broad – works on many different types of bacteria Limited – works on only select types of bacteria

31. Unit 6 - 400 Draw the basic structure of an animal virus and label the following parts clearly: capsid, DNA, protein keys

32. Unit 6 - 500 Describe the process of the Gram staining procedure. Step 1 – stain with purple stain Step 2-wash Step 3-stain with pink stain Step 4-wash Cells that are purple still = Gram + since they have a thick cell wall Cells that are pink = Gram – since they do not have a thick cell wall