1. ©1999 Timothy G. Standish Hebrews 1:1-2 1God, who at sundry times and in divers manners spake in time past unto the fathers by the prophets, 2Hath in these last days spoken unto us by his Son, whom he hath appointed heir of all things, by whom also he made the worlds;

2. ©1999 Timothy G. Standish Controlling Gene Expression Timothy G. Standish, Ph. D.

3. ©1999 Timothy G. Standish All Genes Can’t be Expressed At The Same Time Some genes are needed for the function of all cells all the time. These genes are called constitutive genes and are expressed by all cells. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled in most cells. For example, beta cells in the pancreas make the protein insulin by expressing the insulin gene. If neurons expressed insulin, problems would result.

4. ©1999 Timothy G. Standish Operons Are Groups Of Genes Expressed By Prokaryotes The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together

5. ©1999 Timothy G. Standish The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose Lactose is a sugar that E. coli is unlikely to encounter, so it would be wasteful to produce the proteins needed to metabolize it unless necessary Metabolizing lactose for energy only makes sense when two criteria are met: –Other more readily metabolized sugar (glucose) is unavailable –Lactose is available

6. ©1999 Timothy G. Standish The Lac Operon - Parts The lac operon is made up of a control region and four genes The four genes are: –LacZ -  -galactosidase - An enzyme that hydrolyzes the bond between galactose and glucose –LacY - Codes for a permease that lets lactose across the cell membrane –LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain –Repressor - A protein that works with the control region to control expression of the operon

7. ©1999 Timothy G. Standish The Lac Operon - Control The control region is made up of two parts: Promoter –These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur –The lac operon promoter also has a binding site for another protein called CAP Operator –The binding site of the repressor protein –The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

8. ©1999 Timothy G. Standish The Lac Operon: When Glucose Is Present But Not Lactose RepressorPromoter LacYLacALacZ Operator CAP Binding RNA Pol. Repressor mRNA Hey man, I’m constitutive Come on, let me through No way Jose! CAP

9. ©1999 Timothy G. Standish The Lac Operon: When Glucose And Lactose Are Present RepressorPromoter LacYLacALacZ Operator CAP Binding Repressor mRNA Hey man, I’m constitutive CAP Lac Repressor X RNA Pol. RNA Pol. Great, I can transcribe! Some transcription occurs, but at a slow rate This lactose has bent me out of shape

10. ©1999 Timothy G. Standish The Lac Operon: When Lactose Is Present But Not Glucose RepressorPromoter LacYLacALacZ Operator CAP Binding Repressor mRNA Hey man, I’m constitutive CAP cAMP Lac Repressor X This lactose has bent me out of shape CAP cAMP CAP cAMP Bind to me Polymerase RNA Pol. RNA Pol. Yipee…!

11. ©1999 Timothy G. Standish The Lac Operon: When Neither Lactose Nor Glucose Is Present RepressorPromoter LacYLacALacZ Operator CAP Binding CAP cAMP CAP cAMP CAP cAMP Bind to me Polymerase RNA Pol. Repressor mRNA Hey man, I’m constitutive Repressor STOP Right there Polymerase Alright, I’m off to the races... Come on, let me through!

12. ©1999 Timothy G. Standish The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: –Using a repressor that works in exactly the opposite way from the lac operon repressor –Using a special attenuator sequence

13. ©1999 Timothy G. Standish The Tryptophan Biochemical Pathway O - OOC OH HN H H -2 O 3 P OH H H CH 2 O 5-Phosphoribosyl-  -Pyrophosphate PP i N-(5’- Phosphoribosyl) -anthranilate COO - H CH 2 C HO H O Chorismate - OOC OH -2 O 3 POCH 2 NHNH CHCH CC H OH C H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate NHNH - OOCCH 2 NH 3+ C H Tryptophan H2OH2O Serine Anthranilate COO - NH 2 Glutamate + Pyruvate Glutamine CO 2 +H 2 O -2 O 3 POCH 2 CHCH CC H OH C H NHNH Indole-3-glycerol phosphate Glyceraldehyde- 3-phosphate NHNH Indole Anthranilate synthetase (trpE and D) Anthranilate synthetase N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) Tryptophan synthetase (trpB and A) N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase Tryptophan synthetase

14. ©1999 Timothy G. Standish The Trp Operon: When Tryptophan Is Present STOP Right there Polymerase Trp Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. RNA Pol. Foiled Again! Repressor mRNA Hey man, I’m constitutive

15. ©1999 Timothy G. Standish The Trp Operon: When Tryptophan Is Absent Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor needs his little buddy tryptophan if I’m to be stopped I need tryptophan

16. ©1999 Timothy G. Standish Attenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

17. ©1999 Timothy G. Standish 3’ 5’ 3’ Transcription And Translation In Prokaryotes Ribosome 5’ mRNA RNA Pol.

18. ©1999 Timothy G. Standish Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU- UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA- AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGA GCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA- AAA-CCG trpE... Terminator The Trp Leader and Attenuator 4 12 3

19. ©1999 Timothy G. Standish The mRNA Sequence Can Fold In Two Ways 4 1 2 3 Terminator hairpin 4 12 3

20. ©1999 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Starved For Tryptophan 4 1 2 3 RNA Pol. Ribosome Help, I need Tryptophan

21. ©1999 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present 4 1 2 3 RNA Pol. Ribosome RNA Pol.

22. ©1999 Timothy G. Standish Control Of Expression In Eukaryotes Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site In addition to controlling transcription, there are additional ways in which expression can be controlled in eukaryotes

23. ©1999 Timothy G. Standish Eukaryotes Have Large Complex Genomes The human genome is about 3 x 10 9 base pairs or ≈ 1 m of DNA Because humans are diploid, each nucleus contains 6.3 x 10 9 base pairs or ≈ 2 m of DNA That is a lot to pack into a little nucleus!

24. ©1999 Timothy G. Standish Eukaryotic DNA Must be Packaged Eukaryotic DNA exhibits many levels of packaging The fundamental unit is the nucleosome, DNA wound around histone proteins Nucleosomes arrange themselves together to form higher and higher levels of packaging.

25. ©1999 Timothy G. Standish Highly Packaged DNA Cannot be Expressed The most highly packaged form of DNA is “heterochromatin” Heterochromatin cannot be transcribed, therefore expression of genes is prevented Chromosome puffs on some insect chomosomes illustrate where active gene expression is going on

26. ©1999 Timothy G. Standish Only a Subset of Genes is Expressed at any Given Time It takes lots of energy to express genes Thus it would be wasteful to express all genes all the time By differential expression of genes, cells can respond to changes in the environment Differential expression, allows cells to specialize in multicelled organisms. Differential expression also allows organisms to develop over time.

27. ©1999 Timothy G. Standish A “Simple” Eukaryotic Gene Terminator Sequence Promoter/ Control Region Transcription Start Site 3’5’ RNA Transcript Introns Exon 2Exon 3 Int. 2 Exon 1 Int. 1 3’ Untranslated Region 5’ Untranslated Region Exons

28. ©1999 Timothy G. Standish Eukaryotic mRNA Protein Coding Region 3’ Untranslated Region5’ Untranslated Region Exon 2Exon 3Exon 1 AAAAA G 3’5’ 3’ Poly A Tail5’ Cap RNA processing achieves three things: Removal of introns Addition of a 5’ cap Addition of a 3’ tail This signals the mRNA is ready to move out of the nucleus and may control its lifespan in the cytoplasm

29. ©1999 Timothy G. Standish 5’ DNA 3’ Enhancers EnhancerTranscribed Region 3’ 5’ TF 3’ 5’ TF 5’ RNA Pol. RNA Pol. Many bases Promoter

30. ©1999 Timothy G. Standish