Download presentation
Presentation is loading. Please wait.
Published byKaren Norton Modified over 9 years ago
1
Development & Optimization of a Sensitive & Specific Quantitative Real-Time PCR Assay for Borrelia lonestari HaoQi (Esther) Li 06/21/06 – 08/11/06
2
U.S. Naval Medical Research Center Infectious Diseases Directorate Infectious Diseases Directorate Rickettsial Diseases Department Rickettsial Diseases Department 503 Robert Grant Avenue 503 Robert Grant Avenue Silver Spring, MD 20910
3
Mentors Dr. Allen Richards Dr. Allen Richards Former Director of Rickettsial Diseases Department Former Director of Rickettsial Diseases Department Dr. Ju Jiang Dr. Ju Jiang Naval Medical Research Center Scientist Naval Medical Research Center Scientist
4
Organization My role: science researcher My role: science researcher Working environment: Working environment: Clean room Clean room Dirty hood Dirty hood Smart cyclers Smart cyclers Safety Safety
5
Problem/Rationale Borrelia lonestari Borrelia lonestari Newly discovered Newly discovered not related to Rickettsia not related to Rickettsia Southern Tick-Associated Rash Illnesses (STARI) Southern Tick-Associated Rash Illnesses (STARI) Resembles Lyme disease Resembles Lyme disease Not Borrelia burgdorferi Not Borrelia burgdorferi Diagnosis problem Diagnosis problem
6
Purpose/Goal To find a molecular probe sensitive and specific for Borrelia lonestari flagellin gene
7
Borrelia lonestari Bacteria Spirochete is spiral shaped Spirochete is spiral shaped Carried by lone-star ticks Carried by lone-star ticks http://www.health.state.ok.us/program/cdd/STARI.htm The Borrelia burgdorferi spirochete: the agent of Lyme disease http://www.marvistavet.com/html/body_lyme_disease.html
8
Infection of Bacteria Rash Illnesses Rash Illnesses Location Location http://newsletter.mydna.com/health/diseases/lyme/othertick/staritick.html Patient with a classic erythema migrans; 1) site of tick bite, 2) red, radial, expanding edge of rash. 3) central clearing.
9
Previous Research Cultured isolation Cultured isolation PCR-RFLP PCR-RFLP Deer samples Deer samples http://www.policlinicagipuzkoa.com/GeneticaMolecular/imagenes/PROTOMBINA2.jpg
10
Beacon Probe + qPCR FAM reporter and Black Hole Quencher 1 FAM reporter and Black Hole Quencher 1 Quantitative real-time PCR Quantitative real-time PCR http://www.marine.usf.edu/microbiology/nasba.shtmlhttp://bio.takara.co.jp/catalog/catalog_d.asp?C_ID=C1322
11
Assays Find unique sequence of B. lonestari Find unique sequence of B. lonestari Use full-gene primers to clone the gene Use full-gene primers to clone the gene 11F Primer 594F Primer 655 FAM 719R Primer 970R Primer
12
Assay Materials NCBI GenBank – find NCBI GenBank – find Basic Local Alignment Search Tool – relate Basic Local Alignment Search Tool – relate ClustalW – align ClustalW – align GeneDoc – color unique bp GeneDoc – color unique bp GeneSequence (5’ – 3’) starting from 655 base pair Borrelia species GCAGCTCCAGCTCCAGCAGCAGCTCCAGCTCAAGGTGGAGTTAA Borrelia lonestari CCAGCTCCAGCTC AAGGTGGGATTAG
13
Optimization Tests Primers Primers Probe Probe MgCl 2 MgCl 2 Annealing Temperature Annealing Temperature Concentration variations testing all done by qPCR Concentration variations testing all done by qPCR
14
Sensitivity Tests Full gene PCR Full gene PCR Concentration calculation Concentration calculation qPCR standard tests qPCR standard tests
15
Specificity Tests Types Types 7 related Borrelia spp. 7 related Borrelia spp. 23 non-related bacteria DNA 23 non-related bacteria DNA Hypothesis Hypothesis qPCR qPCR
16
Results: Initial Testing of Assay
17
Results: Transformant DNA
18
Results: Assay Sensitivity
19
Results: Assay Sensitivity Line
20
Results: Assay Specificity Negative results Negative results Implications Implications
21
Conclusions Primers and probe Primers and probe create a specific and sensitive B. lonestari qPCR assay. create a specific and sensitive B. lonestari qPCR assay. The assay The assay Sensitive Sensitive Specific Specific Future research Future research clinical samples clinical samples
22
Reflections Wonderful learning experience Wonderful learning experience Patient, informative mentors Patient, informative mentors Relaxed environment Relaxed environment Long drive, but worth the effort Long drive, but worth the effort http://www.nmrc.navy.mil/nmrc_stdt_main. htm http://www.nmrc.navy.mil/nmrc_stdt_main. htm http://www.nmrc.navy.mil/nmrc_stdt_main. htm http://www.nmrc.navy.mil/nmrc_stdt_main. htm http://www.asee.org/SEAP/index.cfm http://www.asee.org/SEAP/index.cfm http://www.asee.org/SEAP/index.cfm
23
Acknowledgements Dr. Allen L. Richards, Director Rickettsial Diseases Department Dr. Allen L. Richards, Director Rickettsial Diseases Department Dr. Ju Jiang, Navy Medical Research Center Dr. Ju Jiang, Navy Medical Research Center Dr. Barbara Wood, Thomas Jefferson High School for Sci. & Tech. Dr. Barbara Wood, Thomas Jefferson High School for Sci. & Tech. Mr. Fred Lampazzi, Thomas Jefferson High School for Sci. & Tech. Mr. Fred Lampazzi, Thomas Jefferson High School for Sci. & Tech. Joey Flyer, University of Rochester Joey Flyer, University of Rochester Science & Engineering Apprentice Program, NMRC Science & Engineering Apprentice Program, NMRC TJHSST Mentorship Program TJHSST Mentorship Program
24
Literature Cited Burkot, T. R., Mullen, G. R., Anderson, R., Schneider, B. S., Happ, C. M., & Zeidner, N. S. (2001, May/June). Borrelia lonestari DNA in adult Amlyomma americanum ticks, Alabama. Emerging Infectious Diseases, 7(3), 471-473. Burkot, T. R., Mullen, G. R., Anderson, R., Schneider, B. S., Happ, C. M., & Zeidner, N. S. (2001, May/June). Borrelia lonestari DNA in adult Amlyomma americanum ticks, Alabama. Emerging Infectious Diseases, 7(3), 471-473. Fukunaga, M., Okada, K., Nakao, M., Konishi, T., & Sato, Y. (1996, October). Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of lyme disease Borreliae. International Journal of Systematic Bacteriology, 46(4), 898-905. Fukunaga, M., Okada, K., Nakao, M., Konishi, T., & Sato, Y. (1996, October). Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of lyme disease Borreliae. International Journal of Systematic Bacteriology, 46(4), 898-905. Jiang, J., Chan, T.-C., Temenak, J. J., Dasch, G. A., Ching, W.-M., & Richards, A. L. (2004). Development of a Quantitative Real-Time Polymerase Chain Reaction assay specific for Orientia tsutsugamushi. American Society of Tropical Medicine and Hygiene, 70(4), 351-356. Jiang, J., Chan, T.-C., Temenak, J. J., Dasch, G. A., Ching, W.-M., & Richards, A. L. (2004). Development of a Quantitative Real-Time Polymerase Chain Reaction assay specific for Orientia tsutsugamushi. American Society of Tropical Medicine and Hygiene, 70(4), 351-356. Jiang, J., Temenak, J. J., & Richards, A. L. (2003). Real-time PCR duplex assay for Rickettsia prowazekii and Borrelia recurrentis. In K. E. Hechemy, T. Avsic-Zupanc, J. E. Childs, & D. A. Raoult (Eds.), Rickettsiology present and future directions (pp. 302- 310). New York: New York Academy of Sciences. From Rickettsiology Present and Future Directions. Jiang, J., Temenak, J. J., & Richards, A. L. (2003). Real-time PCR duplex assay for Rickettsia prowazekii and Borrelia recurrentis. In K. E. Hechemy, T. Avsic-Zupanc, J. E. Childs, & D. A. Raoult (Eds.), Rickettsiology present and future directions (pp. 302- 310). New York: New York Academy of Sciences. From Rickettsiology Present and Future Directions. Moore IV, V. A., Varela, A. S., Yabsley, M. J., Davidson, W. R., & Little, S. E. (2003, January). Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from the southeastern United States. Journal of Clinical Microbiology, 41(1), 424-427. Moore IV, V. A., Varela, A. S., Yabsley, M. J., Davidson, W. R., & Little, S. E. (2003, January). Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from the southeastern United States. Journal of Clinical Microbiology, 41(1), 424-427.
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.