1. Introductory Genetics

2. Overview of talks This talk: broad overview of genetics
Future talks: genetic data analysis
Important general genetic concepts
heritability, penetrance, linkage/linkage disequilibrium, Hardy-Weinberg equilibrium
Types of genetic analysis
association analysis
family-based vs population-based
candidate gene vs genome scan
genotype v haplotype
problems: population stratification, missing data, data errors, inferring haplotypes
twin studies
“Omics”: genomics, proteomics, metabolomics, genetical genomics, integrative genomics
The idea of this talk is to give a grounding in basic genetics, and to help in understanding studies that involve analysis of genetic data. I’m aware that for many of you this talk will be a bit basic, hopefully you’ll still find that it clarifies some concepts or explains some jargon. Please feel free to butt in and ask questions.
Future talks will be more directly relevant to the Robertson Centre and will focus on statistical analysis of genetic data. Many of the statistical techniques will be ones I’ve never used but that people here have used, so I’ll be hoping to learn something from the statisticians as well as giving an idea of how genetic data is analysed.

3. Overview of this talk Why genetics is important How genes work
Mendel’s laws of inheritance for simple genetic traits
“Post-genomic” genetics
I’ve divided the talk into 5 sections. First I’ll say why it’s useful to include genetic variation as part of our analyses.
Then I’ll take you through the basics of what genes are and how they function.
An important aspect of any genetic trait is its mode of inheritance. The laws of inheritance were worked out by Mendel about 140 years ago.
I’ll then bring us up to date by running through the major discoveries in genetics since then, and I’ll finish by saying a bit about what recent advances like the sequencing of the human genome have made possible in searching for medically relevant genes.

4. Why genetics is important

5. Genetics G×E interaction Environment Health
Why does genetics matter (to the Robertson Centre)? Genetics is a subject with very broad applications in understanding evolution, development, ecology, molecular biology, forensics. One of the main applications of genetics is to understanding variation in human health. e.g. how genes can contribute to disease.
h^2
California Cholesterol levels 50-90%
Scandinavia Mortality due to heart disease 50-60%

6. The number of journal articles that deal with genetic and disease has increases steadily over the past 15 years. This isn’t because we’ve suddenly realised that genetic factors are important in disease, but because of dramatic technical innovations that allow us to gather lots of genetic data quickly and cheaply.

7. How genes work
SO if we’re going to inderstand how genetic mutations can contribute to disease, or to differences in drug effectiveness, we need to understand how genes work.

8. What is a gene?
A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein)
DNA
Protein
…GAATTCTAATCTCCCTCTCAACCCTACAGTCACCCATTTGGTATATTAAAGATGTGTTGTCTACTGTCTAGTATCC…
Computer program
Specific function
…function sf(){document.f.q.focus()}…
mRNA
Working copy
First of all, what is a gene? There’s been a great deal of debate about this, but for must purposes a gene can be defined as …
For example this string of letters is part of the DNA sequence of the beta-haemoglobin gene, which makes part of the protein haemoglobin.
So DNA stores information, and pr

9. Genes are located in the cell nucleus on chromosomes
Karyotype
We have two copies of each chromosome, one from each parent.
The human genome is the all of the genetic information in our chromosomes, plus some DNA that is held in the cytoplasm which I’ll mention later.
mtDNA

10. Down syndrome karyotype (trisomy 21)

11. DNA (deoxyribonucleic acid)
Protein
DNA (deoxyribonucleic acid)
mRNA

12. A:T and G:C

13. Transcription movie

14. Translation
Happens at ribosome

15. Translation

16. Translation

17. Translation movie

18. Gene expression movie

19. Summary
A gene is a length of DNA that contains instructions for making a specific protein
Genes are arranged along 23 pairs of chromosomes in the cell nucleus
Genes work by specifying the amino acid sequence of a protein
We have about genes, but only 98.5% of our DNA is made up of genes. Our entire complement of 3 billion letters of DNA (our genome) is divided into 23 chromosomes, which stay in the cell nucleus

20. Mendel’s laws
Now we know a bit about how genes work, we need to know how the are inherited.

21. Genetic knowledge used for 1000s of years: agriculture
Genetics, in its untrained form, has been around for at least 10,000 years, since farmers started using their knowledge of inheritance to enhance crops and livestock through selective breeding.

22. Patterns of disease inheritance known for 1000s of years, e. g
Patterns of disease inheritance known for 1000s of years, e.g. haemophilia
This is a pedigree showing the inheritance of one of the best known genetic diseases, haemophilia, in the royal family. The inheritance of haemophilia is now well understood

23. Mendel deduced the underlying principles of genetics from these patterns
Segregation
Dominance
Independent assortment
Mendel summarised his findings in two laws of inheritance.

24. Mendel’s experiments

25. Mendel’s data

26. Mendel’s law of segregation
A normal (somatic) cell has two variants (alleles) for a Mendelian trait.
A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles.
E.g. if you have one allele for brown eyes (B) and one for blue eyes (b), somatic cells have Bb and each gamete will carry one of B or b chosen randomly.
Sperm B b BB Bb bb
Autosomal e.g. iris pigment cell
Eggs

27. Mendel’s law of dominance
If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive.
Sperm B b BB Bb bb
Clearly many traits are much more complicated than this, but Mendel concentrated on simple traits because these were the ones that allowed the fundamental laws to be deduced from which the theory behind more complex traits was later developed.
Eggs

28. Mendel’s law of dominance
If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive.
Sperm B b BB Bb bb
Eggs

29. Terminology… B b BB Bb bb
Haploid: containing one copy of each chromosome (n=23)
Diploid: containing two copies of each chromosome
(2n=46)
Sperm B b BB Bb bb
Eggs

30. Terminology… Genotype Phenotype
Genotype: the states of the two alleles at one or more locus associated with a trait
Phenotype: the state of the observable trait
Genotype
Phenotype
BB (homozygous)
Brown eyes
Bb (heterozygous)
bb (homozygous)
Blue eyes
phenotype is fn of genotype, environment and age

31. Mendel’s law of independent assortment
Knowledge of which allele has been inherited at one locus gives no information on the allele has been inherited at the other locus
S/s
Y/y SY Sy sY sy
25%
25%
25%
25%

32. Mendel’s law of independent assortmentY s y
Gametophytes(gamete-producing cells)
Gametes A b a B
Recombinants
Segregation
Find out if they really were linked

33. Mendel’s law of independent assortmentY s y
Gametophytes
(gamete-producing cells)
Gametes
Recombinants
Recombination
Segregation
Here we’re labelling the DNA from the father red and the mother blue.

34. Statistical aside: Mendel’s data too good to be true?

35. Human eye colour B b BB Bb bb
Simplified view of eye colour inheritance: biallelic Mendelian trait
Brown dominant: BB, Bb
Blue recessive: bb
Sperm B b BB Bb bb
A common game that parents-to-be play
Eggs

36. Human eye colour ?
What is the probability of a child being born with blue eyes?
Go through pedigree. Squares mean males, circles women, diamonds usually mean unborn children of unknown sex. If we know nothing about the child, the prob that it will have blue eyes is the population frequency, which in the UK is about ¼. However, we do know the eye colour of relatives of the child. Ideally, we would like to know the genotype

37. Human eye colour ?

38. Human eye colour B? bb B? B? ? bb B? B?

39. Human eye colour B? bb Bb Bb ? bb B? Bb

40. Human eye colour Bb Bb ? B? Bb

41. Human eye colour Bb Bb ?
P(BB)=1/3 Bb
P(Bb)=2/3

42. Human eye colour ? Bb Bb Bb P(BB)=1/3 P(Bb)=2/3 P(b)=2/3x1/2=1/3

43. Human eye colour ? Bb Bb Bb P(bb)=1/3x1/2=1/6 P(BB)=1/3 P(Bb)=2/3
P(b)=2/3x1/2=1/3
P(b)=1/2
P(bb)=1/3x1/2=1/6

44. Non-Mendelian inheritance: Haemophilia
Haemophilia A
Males with a mutant gene are affected
Females with one mutant gene are unaffected carriers
Another area where genetics is important is medicine. Genetic diseases have also been known for many centuries. A good example of this is haemophilia.

45. Non-Mendelian inheritance: additive traits
Snapdragons
Antirrhinum majus

46. Non-Mendelian inheritance: additive traits
Brown eye colour is dominant
Snapdragons
Antirrhinum majus

47. Non-Mendelian inheritance: additive traits
Snapdragon red colour is additive
Snapdragons
Antirrhinum majus

48. Non-Mendelian inheritance: polygenic traits

49. Non-Mendelian inheritance: polygenic traits

50. Non-Mendelian inheritance: polygenic traits

51. Non-Mendelian inheritance: polygenic traits
For example, height

52. Non-Mendelian inheritance: mtDNA

53. Phenotypes associated with mtDNA mutations
Longevity
Optic neuritis
Occipital stroke in migraine
Asthenozoospermia
Migraine without aura
Cyclic vomiting syndrome
Bipolar disorder
Athletic performance

54. Summary Mendel deduced three simple laws of inheritance:
Segregation
Dominance
Random assortment
The majority of traits don’t follow these rules but Mendel’s laws are nevertheless crucial to understanding almost all genetic inheritance

55. “Post-genomic” genetics

56. Human Genome Project
Sequenced almost all 3 billion DNA base pairs (2003)
Current work includes:
ENCODE Project (ENCyclopedia Of DNA Elements) to characterise functional elements in genome
20,000-25,000 genes (1.5% of genome)
The bits in between (98.5% of genome)
Characterise human DNA sequence variation
Find and describe DNA sequence variation (International HapMap Project)
Find significance of sequence variation (e.g. contribution to complex diseases)

57. HapMap project HGP: 1st step in understanding stuff
HapMap – diffs between genomes, opportunity to study all human genetic variation. Implications are wide, but for RCB puroses it potentially allows us to find all tge variation behind disease, drug response, etc. relevant to human health
Com[lex diseases

58. Frequency
Case 0.200
Control 0.165
Odds ratio: 1.26

59. Eye-catching headline of the form “Gene for…”
Highly qualified factual paragraph

60. HTR1D
At least seven genes have been associated with OCD. This one wasn’t replicated by a subsequent study, and wasn’t picked out by a whole genome scan.
This is not to say that this gene isn’t involved in OCD, but that preliminary findings of an association
HTR1D

62. Summary
Post-genomic genetics has enormous promise for tracking down the genes involved in common complex diseases
Currently our ability to exploit this potential is limited by
study size
difficulty of correcting for confounding factors
The study size problem is being addressed by very large prospective cohort studies such as the UK biobank and the SFHS.
These should enable us to find the many common genes that contribute to common diseases such as diabetes, CHD, alzheimers.
The problem of confounding factors is more tricky, and is currently a fast developing area of statistical research.