Presentation is loading. Please wait.

Presentation is loading. Please wait.

How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Similar presentations


Presentation on theme: "How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes."— Presentation transcript:

1 How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes

2 Morphology O. repensO. spinosa

3 Morphology Ononis repens subsp maritima

4 Morphology Ononis spinosa

5 Geography Ononis repensOnonis spinosa Preston, CD, Pearman, DA and Dines, TD (2002) New Atlas of the British and Irish Flora

6 Cytology O. repens 2n=60 O. spinosa 2n=30 Scale bar = 2μm Morisset (1967) Watsonia 12:145-153

7 Flow Cytometry O. spinosa O. repens Mode =59 Mode = 30

8 Taxonomy

9 Aims How many groups are British Restharrows divided into genetically? Are Ononis repens and Ononis spinosa interbreeding? How does this compare with samples from continental Europe? Do present levels of genetic diversity give cause for concern?

10 Tools Ten microsatellite markers DNA sequence –chloroplast –nuclear: coding and non-coding DNA 700 plant samples from 40 populations

11 Collection sites Key: O. spinosa O. repens O. natrix Other

12 Ten highly polymorphic microsatellites

13 The trouble with tetraploids 10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC 08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC Is indistinguishable from: 10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC 08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC Quantitative scoring:10,10,10,08 and 10,10,08,08 Qualitative scoring: 10,08,00,00 and 10,08,00,00

14 Principal Coordinates Analysis Similarities between cases Euclidian distance –x ik variable X k individual i –x jk same variable individual j

15 PCO British individuals Axis 1 = 10.3 % Axis 2 = 4.2 %

16 PCO British populations Axis 1 = 27 % Axis 2 = 11.5 %

17 PCO all populations Axis 1 = 19.5 % Axis 2 = 14.8 %

18 Neis genetic distance x i, y i frequencies of ith allele in populations X and Y probability that two randomly chosen genes in population X are identical is jx=Σx i 2, in population Y it is jy=Σy i 2 probability of identity for both populations is jxy=Σx i y i. Jx, Jy and Jxy arithmetic means of jx, jy and jxy, over all loci.

19 Neis genetic distance

20 DNA sequencing Chloroplast DNA – trnL spacer Nuclear – β-amyrin sequence:intron/exon/protein Nuclear – microsatellite locus 1 flanking region

21 DNA sequencing For O. repens and O. spinosa: –No variation in chloroplast DNA sequence (except German) –Low variation in β-amyrin sequence, no species differentiation –High variation in microsatellite flanking regions, no species differentiation For other Ononis species, consistent relationships were revealed

22 Conclusions The ten microsatellites are effective –at differentiating O. spinosa and O. repens in Britain –for studying genetic diversity in populations of continental Ononis species The DNA sequences are effective –for cross-species comparisons

23 Conclusions Ononis spinosa and O. repens are not freely interbreeding in Britain The same pattern appears in France There is no further genetic differentiation between ecotypes O. spinosa and O. repens are similar in the DNA sequences studied Levels of genetic diversity are high and do not give cause for concern

24 Thanks! It is my pleasure to acknowledge: Dr Sean Mayes Dr Don MacDonald Dr Peter Dean Chris Maddren Dr. François Balloux Dr. Johannes Vogel Cambio and BBSRC


Download ppt "How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes."

Similar presentations


Ads by Google