Download presentation
Presentation is loading. Please wait.
Published byKevin Short Modified over 11 years ago
1
Population Genetics 3 We can learn a lot about the origins and movements of populations from genetics Did all modern humans come from Africa? Are we derived from Neanderthals? Are dogs really a type of wolf?
2
DNA Polymorphisms Many DNA sequences are polymorphic (have different alleles) A common type of polymorphism is SNPs (single nucleotide polymorphisms, e.g. C/T) Another type is microsatellite repeats, e.g…...(CA) n...…where n, the number of repeats, is variable, and mutates more quickly than SNPs do
3
Microsatellite DNA polymorphisms....CACACACACACA.... chromosome PCR No. of CAs varies (alleles) DNA fragments Electrophoresis 1 2 3 4 5 large small
4
Deducing the haplotype The combination of alleles for two or more linked markers, on a single individual chromosome, is called a haplotype In a haploid organism (one of each chromosome) it is obvious what the haplotype is In a diploid, it is not always obvious Example: 2 markers on human X chromosome, female with genotype a/a for 1st marker and c/c for 2nd - haplotypes are both a - c But if genotypes are a/c and a/c, haplotypes could be a - a and c - c, or a - c and c - a
5
Haplotypes and recombination In a diploid organism reproducing sexually, new haplotypes can be formed by recombination a ag gg g a a g g Mum and Dads X chromosomes Daughters X chromosome haplotypes show there must have been recombination in Mum
6
Haplotypes and mutation New haplotypes can also be formed by mutation a c t g c t g a t g a a
7
Non-recombining regions of genome To make a phylogeny from haplotypes it is best to use regions of genome that dont recombine, because then only have to consider effects of mutation In mammals, these regions include the Y chromosome and the mitochondrial chromosome Both systems are routinely used for population studies
8
The human Y chromosome The mammalian X and Y chromosomes evolved from a pair of autosomes The human Y has a block of material that transposed (moved) from the X since the divergence of chimps and humans
9
The mitochondrial chromosome About 15kb of DNA Mutates quite rapidly In eggs but not sperm, so shows maternal inheritance
11
Human origins The multi-regional hypothesis says that modern humans evolved from Homo erectus independently on different continents starting about 1,000,000 years ago The out-of-Africa hypothesis is that all modern humans are derived from immigrants of African origin that displaced the indigenous types (such as Neanderthals) The variation in modern human mitochondrial DNA suggests common ancestor lived about 200,000 years ago
13
Phylogeny based on haplotypes If there has been no recombination, we can deduce the phylogeny of the haplotypes by parsimony acgttgcaagcaaccaacgtacga Outgroup e.g. chimp Modern humans Mutation
14
Y chromosomes and human origins Are all modern humans of African origin? Africa Europe, Asia Time of migration African mutationsNon-African mutations Common ancestor
15
Are modern humans descended from Neanderthals? Neanderthal and Cro-Magnon mitochondrial isolated from fossils Modern humans are very similar to Cro- Magnon (who lived about 24,000 years ago), much less similar to Neanderthal (common ancestor 600,000 years ago) Ancestors of modern humans (e.g. Cro- Magnon) believed to have displaced indigenous Neanderthal types in Europe and other regions of world about 30,000 years ago
16
Dogs and wolves Mitochondrial DNA from modern dogs ( - ) and wolves ( ) Domestic dogs and wolves are on same branches, coyote (wild dog) on a different branch
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.